Difference between revisions of "Talk:20.109(S13):Context-setting and primer design (Day1)"

From OpenWetWare
Jump to: navigation, search
(Update for everyone)
(13 intermediate revisions by 2 users not shown)
Line 3: Line 3:
As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for ''V corneae''. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).
As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for ''V corneae''. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked [[Media:Vcorneae_SSU-Broad-direct.gb | here]]. For comparison, the complete sequences from [[Media:Vcorneae_SUU-complete-Baker.gb | Baker et al]] and [[Media:Vcorneae_SSU-complete-DaSilva.gb‎ | DaSilva et al.]] are each linked. You can ''Align Sequences'' (under ''Tools'') in ApE to see the differences for yourself.<font color=red>In progress for WF.</font color>
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked [[Media:Vcorneae_SSU-Broad-direct.gb | here]]. For comparison, the complete sequences from [[Media:Vcorneae_SUU-complete-Baker.gb | Baker et al]] and [[Media:Vcorneae_SSU-complete-DaSilva.gb‎ | DaSilva et al.]] are each linked. You can ''Align Sequences'' (under ''Tools'') in ApE to see the differences for yourself.
As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 &deg;C and one at Ta = 53 &deg;C.
As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 &deg;C and one at Ta = 53 &deg;C.
Line 9: Line 9:
However, if you would like to revise your primers to a Tm of 63 &deg;C, we will accept these new designs through Monday at 9 pm.
However, if you would like to revise your primers to a Tm of 63 &deg;C, we will accept these new designs through Monday at 9 pm.
==T/R section==
==T/R section (primer check in progress)==
Please sign up for one of the design challenges -- four teams per challenge -- right away.
Please sign up for one of the design challenges -- four teams per challenge -- right away.
Line 36: Line 36:
|CGG AAC CAA ACC CTG AT<br>Agi: CGG '''T'''AC '''A'''AA ACC CT'''A''' AT<br>new G/C = 41%, new Tm = 55.9    
|CGG AAC CAA ACC CTG AT<br>Agi: '''C''' CGG '''T'''AC '''A'''AA ACC CT'''A''' AT<br>new G/C = 44.4%, new Tm = 55.8<br>added 1 extra base to increase Tm    
|bp 5
|bp 5
|bp 236
|bp 236
Line 43: Line 43:
|ttctgcctgacgtagatg<br>Agi: fine
|ttctgcctgacgtagatg<br>Agi: fine
|cctctccggaaccaaac<br>Agi: CCT CTC CGG '''T'''AC '''A'''AA AC <br>new G/C = 52.9%, new Tm = 58.4
|cctctccggaaccaaac<br>Agi: CCT CTC CGG '''T'''AC '''A'''AA AC <br>new G/C = 52.9%, new Tm = 55.6
|bp 12
|bp 12
|bp 226
|bp 226
Line 49: Line 49:
|CTGACGTGGATGCTATTC<br>Agi: ctg acg t'''a'''g atg cta '''g'''tc<br>new G/C = 50%, new Tm = 55.1
|CTGACGTGGATGCTATTC<br>Agi: '''c''' ctg acg t'''a'''g atg cta '''g'''tc<br>new G/C = 50%, new Tm = 56.4 - oops, 55.1<br>added one more "c" at 5' for Tm = 57.7
|bp 18
|bp 18
Line 78: Line 78:
|CCT TCG TCC TTC ATC ACC ACA A<br>Agi: CCT TCG TCC TT'''G''' ATC ACC '''GA'''A '''T''' (yours doesn't match ''any'' known sequence in last 4 bp -- do I have right region?)
|CCT TCG TCC TTC ATC ACC ACA A<br>Agi: CCT TCG TCC TT'''G''' ATC ACC '''GA'''A '''T''' (yours doesn't match ''any'' known sequence in last 4 bp -- do I have right region?)<br>new G/C = 50%, new Tm = 63.5
|bp 6, F
|bp 6, F
|bp 588, R
|bp 588, R
Line 92: Line 92:
|GTCAACGTCACTGTCTTGG<br>Agi: GTC AAC '''C''' GTC ACT GTC TTG G (insertion) <br>new G/C = 55%, new Tm = 64.3
|GTCAACGTCACTGTCTTGG<br>Agi: GTC AAC '''C''' GTC ACT GTC TTG G (insertion) <br>new G/C = 55%, new Tm = 61.8
Line 120: Line 120:
|5' GGACGGCTCAGTGATAG 3'<br>Agi:fine for EH
|5' CTACCACACCCAGAACTTAC 3'<br>Agi:fine for EH
|bp 84, F
|bp 84, F
|bp 167, R
|bp 167, R
Line 127: Line 127:
|5' CATCACCACAAAAGTCCAA 3'<br>Agi:fine for EH
|bp 359, F  
|bp 359, F  
|bp 630, R
|bp 630, R
Line 135: Line 135:
|5' CCA GGT TGA TTC TGC CTG 3' <br>Agi:fine
|5' CCA GGT TGA TTC TGC CTG 3' <br>Agi:fine
|5' CTC TCC GGA ACC AAA CC 3' <br>Agi: CTC TCC GG'''T''' AC'''A''' AAA CC
|5' CTC TCC GGA ACC AAA CC 3' <br>Agi: CTC TCC GG'''T''' AC'''A''' AAA CC<br>new G/C = 53%, new Tm = 55.6
|bp 9, F
|bp 9, F
|bp 225, R
|bp 225, R
Line 141: Line 141:
| 5' CAT GTT GAT TCT GCC TGA C 3'<br>Agi:fine for EH
| 5' CTC TCC TGA ACC AAA CCC TG 3'<br>Agi:fine for EH
| bp 4, F
| bp 4, F
| bp 278, R
| bp 278, R
Line 168: Line 168:
|bp 64
|bp 64
|bp 169
|bp 169
Line 176: Line 176:
|CTGTCTTGGTAGTCCACTAC <br>Agi: CTG TCT TGG TAG TCC '''ATTAC''' AC TAC (5 insertions -- but ''no'' sequence that I found matches yours, most only require 1 insertion -- so check your work please)
|CTGTCTTGGTAGTCCACTAC <br>Agi: CTG TCT TGG TAG TCC '''ATTAC''' AC TAC (5 insertions -- but ''no'' sequence that I found matches yours, most only require 1 insertion -- so check your work please)<br>new G/C = 44%, new Tm = 61.7
|bp 14
|bp 14
|bp 203
|bp 203

Latest revision as of 09:50, 19 February 2013

Update for everyone

As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for V corneae. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).

Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked here. For comparison, the complete sequences from Baker et al and DaSilva et al. are each linked. You can Align Sequences (under Tools) in ApE to see the differences for yourself.

As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C.

However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm.

T/R section (primer check in progress)

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CAT GCT TGC CAA CAC AG
Agi: PT so unchanged
Agi: PT so unchanged
bp 9 bp 251 E. Hellem: polar tube protein gene
Agi: fine
new G/C = 44.4%, new Tm = 55.8
added 1 extra base to increase Tm
bp 5 bp 236 VC: SSU rRNA
Pink ttctgcctgacgtagatg
Agi: fine
new G/C = 52.9%, new Tm = 55.6
bp 12 bp 226 VC
Agi: c ctg acg tag atg cta gtc
new G/C = 50%, new Tm = 56.4 - oops, 55.1
added one more "c" at 5' for Tm = 57.7
Agi: fine
bp 18 bp 199 VC small subunit ribosomal RNA gene


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 93, F bp 879, R VC, SSU rRNA
Agi: CCT TCG TCC TTG ATC ACC GAA T (yours doesn't match any known sequence in last 4 bp -- do I have right region?)
new G/C = 50%, new Tm = 63.5
bp 6, F bp 588, R VC, SSU RNA
Orange 5'cgt agt cat aga agg gca aag ag3'
Agi: fine
5' ctc tct ctc tac ctg cta ttg ta 3'
Agi: fine
441 1005 V. corneae TV4/TV5 SSU rRNA
Agi: fine
Agi: GTC AAC C GTC ACT GTC TTG G (insertion)
new G/C = 55%, new Tm = 61.8
60 195 V. corneae TV4/TV5 SSU rRNA

W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi:fine for EH
Agi:fine for EH
bp 84, F bp 167, R EH, SSU rRNA
Agi:fine for EH
Agi:fine for EH
bp 359, F bp 630, R EH, SSU rRNA
new G/C = 53%, new Tm = 55.6
bp 9, F bp 225, R VC, SSU, rRNA
Platinum 5' CAT GTT GAT TCT GCC TGA C 3'
Agi:fine for EH
Agi:fine for EH
bp 4, F bp 278, R EH, SSU rRNA


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 12 bp 213 for VC TV4 SSU rRNA
Agi: fine; emailed change: GCAATCAGGGACGAATAGCTCAG
bp 64 bp 169 VC SSU rRNA, full sequence
Agi: fine
Agi: CTG TCT TGG TAG TCC ATTAC AC TAC (5 insertions -- but no sequence that I found matches yours, most only require 1 insertion -- so check your work please)
new G/C = 44%, new Tm = 61.7
bp 14 bp 203 VC TV4 SSU rRNA gene
Agi: fine
Agi: fine
bp 841 bp 1049 VC SSU rRNA