Difference between revisions of "Talk:20.109(S13):Context-setting and primer design (Day1)"

From OpenWetWare
Jump to: navigation, search
(Update for everyone)
Line 168: Line 168:
|bp 64
|bp 64
|bp 169
|bp 169

Revision as of 09:21, 19 February 2013

Update for everyone

As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for V corneae. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).

Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked here. For comparison, the complete sequences from Baker et al and DaSilva et al. are each linked. You can Align Sequences (under Tools) in ApE to see the differences for yourself.

As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C.

However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm.

T/R section (primer check in progress)

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CAT GCT TGC CAA CAC AG
Agi: PT so unchanged
Agi: PT so unchanged
bp 9 bp 251 E. Hellem: polar tube protein gene
Agi: fine
new G/C = 44.4%, new Tm = 55.8
added 1 extra base to increase Tm
bp 5 bp 236 VC: SSU rRNA
Pink ttctgcctgacgtagatg
Agi: fine
new G/C = 52.9%, new Tm = 55.6
bp 12 bp 226 VC
Agi: ctg acg tag atg cta gtc
new G/C = 50%, new Tm = 56.4
Agi: fine
bp 18 bp 199 VC small subunit ribosomal RNA gene


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 93, F bp 879, R VC, SSU rRNA
Agi: CCT TCG TCC TTG ATC ACC GAA T (yours doesn't match any known sequence in last 4 bp -- do I have right region?)
new G/C = 50%, new Tm = 63.5
bp 6, F bp 588, R VC, SSU RNA
Orange 5'cgt agt cat aga agg gca aag ag3'
Agi: fine
5' ctc tct ctc tac ctg cta ttg ta 3'
Agi: fine
441 1005 V. corneae TV4/TV5 SSU rRNA
Agi: fine
Agi: GTC AAC C GTC ACT GTC TTG G (insertion)
new G/C = 55%, new Tm = 61.8
60 195 V. corneae TV4/TV5 SSU rRNA

W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi:fine for EH
Agi:fine for EH
bp 84, F bp 167, R EH, SSU rRNA
Agi:fine for EH
Agi:fine for EH
bp 359, F bp 630, R EH, SSU rRNA
new G/C = 53%, new Tm = 55.6
bp 9, F bp 225, R VC, SSU, rRNA
Platinum 5' CAT GTT GAT TCT GCC TGA C 3'
Agi:fine for EH
Agi:fine for EH
bp 4, F bp 278, R EH, SSU rRNA


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 12 bp 213 for VC TV4 SSU rRNA
Agi: fine; emailed change: GCAATCAGGGACGAATAGCTCAG
bp 64 bp 169 VC SSU rRNA, full sequence
Agi: fine
Agi: CTG TCT TGG TAG TCC ATTAC AC TAC (5 insertions -- but no sequence that I found matches yours, most only require 1 insertion -- so check your work please)
new G/C = 44%, new Tm = 61.7
bp 14 bp 203 VC TV4 SSU rRNA gene
Agi: fine
Agi: fine
bp 841 bp 1049 VC SSU rRNA