Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare
Revision as of 15:47, 11 February 2013 by Shannon K. Alford (talk | contribs) (Sensitivity)
Jump to: navigation, search

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CCA TGC TTG CCA ACA CAG G GGT CTG GTT GCT TCC ACT TCC bp 8 bp 227 E. Hellem: polar tube protein gene
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple 5' AGC CGC GGT AAT ACC GAC 3' 5’ GA TTT CTC CCT GCC CAC TGT 3’ bp 385, F bp 699, R VC, SSU rRNA

W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink AGCCATGCATGTTTCCGCAATC tcccgtcaaccgtcactgtc bp 46 bp199 for VC TV4 SSU rRNA