Rm2, RASSL based on hmc4-Receptor

From OpenWetWare
Revision as of 15:47, 26 June 2009 by Elana Urbansky (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


This is the RASSL Melanocortin No. 1. The sequence is identical to hMC4R except for the D122A substitution that renders it a Gs-coupled RASSL. Rm1 has a higher basal activity than the wild-type receptor by ~ 50%.

gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatag ttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagc tacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgc ttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaatt acggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcc tggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa tagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa gtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgc ccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattacca tggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagt ctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcg taacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagag ctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggag acccaagctggctagttaagcttggtaccgagctcggatccactagtccagtgtggtggaattgccct tatcaattcagggggacactggaattcgcccttgcctatctagaataaacgctcaactttggcagatc caccATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATC TACTCTTGTGCCAGGGTGTGGTCTCCGATTACAAAGATGATGATGATGTCGACTCCCCGATCCAGATC TTCCGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGA CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGC TGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTG ACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCG CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGA CAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGC TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC CTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTT CGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACCGGATCCTGAACTCCACCCACCGTG GGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCC CTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGAC TCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGC ATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGA TCAGAAACCATTATCATCACCCCATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATAT TGCTAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTG CAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTT GGGATCAGCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTTGTTCATCATTTACTCAGA TAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCT ATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCC ATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTG CTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCAGAATCCATATTGTGTGTGCT TCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTAT GCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCT TTGTGACTTGTCTAGCAGATATTAAatggggacagagcacgcaatataggaacaaagggcaattctgc agatatccagcacagtggcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatcccta accctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgc tgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttcctt gaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctga gtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaat agcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctag ggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtga ccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttc gccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggca cctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggttt ttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactc aaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaa tgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaa gtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgt ggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccat agtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatg gctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtag tgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcgg atctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctc cggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgcc gccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccct gaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctc ctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatac gcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcgga tggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactg ttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgctt gccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcgg accgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgac cgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttga cgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatca cgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccgg ctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcag cttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcat tctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagcta gagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacaca acatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaatt gcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgct cggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatca ggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctct cctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttc tcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacg aaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaaga cacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgc tacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctc tgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatccttt gatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagat tatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtata tatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccat ctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaac cagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaa ttgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaagg cgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcag aagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgc catccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcgg cgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagt gctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtga gcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcat actcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttg aatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc