Difference between revisions of "Registry/Measurement kit/Notebook/2007-7-31"

From OpenWetWare
Jump to: navigation, search
(New page: ==E0240== *Noticed that during the scarring PCR, a point substitution was made. *Decided to try a site-directed mutagenesis on the biobricked product. *Ordered two pairs of primers: **...)
 
 
Line 12: Line 12:
 
==I2057==
 
==I2057==
 
*Re-transformed both versions with ccdB into DB3.1
 
*Re-transformed both versions with ccdB into DB3.1
 +
 +
==I2055 and I2056==
 +
*Letting biobrick PCR run overnight.
 +
 +
==T9002==
 +
*Re-tried, transformed ligation of F2620.
  
 
==Misc==
 
==Misc==
 
*Made chemically competent DB3.1 cells.
 
*Made chemically competent DB3.1 cells.

Latest revision as of 13:57, 31 July 2007

E0240

  • Noticed that during the scarring PCR, a point substitution was made.
  • Decided to try a site-directed mutagenesis on the biobricked product.
  • Ordered two pairs of primers:
    • First pair - mutation in the ends of the primers:
      • CGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGC, E0240_mut_E_F (78.8)
      • CTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAGG, E0240_mut_E_R (79.7)
    • Second pair - mutation in the middle of the primers:
      • CCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTG, E0240_mut_M_F (80)
      • ACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTG, E0240_mut_M_R (79.3)

I2057

  • Re-transformed both versions with ccdB into DB3.1

I2055 and I2056

  • Letting biobrick PCR run overnight.

T9002

  • Re-tried, transformed ligation of F2620.

Misc

  • Made chemically competent DB3.1 cells.