Recipes & Protocols: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(38 intermediate revisions by the same user not shown)
Line 4: Line 4:
*[http://genome.ucsc.edu/cgi-bin/hgPcr USCS In-silico PCR]
*[http://genome.ucsc.edu/cgi-bin/hgPcr USCS In-silico PCR]
*[http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]
*[http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]
*[http://www.bioinformatics.org/sms/rev_comp.html Reverse complement]
*[http://ecoli.naist.jp/GB8-dev/index.jsp?page=gene_search.jsp&sf=T GenoBase Keio]
*[http://tools.neb.com/NEBcutter2/ DNA Restriction Site Analyzer]


===Gene/Protein Info===
===Gene/Protein Info===
Line 11: Line 14:
*[http://openwetware.org/wiki/Choosing_primers_for_qPCR Choosing primers for q-PCR]
*[http://openwetware.org/wiki/Choosing_primers_for_qPCR Choosing primers for q-PCR]


===Primer designing for BUGS===
===Primer designing for gene expression profiling (bacteria)===


➢Get the gene name  (eg: MYD88)
➢Get the gene name  (eg: MYD88)
Line 17: Line 20:
*Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
*Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
*Click on the link and go to the gene description page.
*Click on the link and go to the gene description page.
*Scroll down and clink on the link to find the CDS.
*Scroll down and clink on the link to find the CDS, or the RefSeq.
*Copy the CDS sequence.
*Copy the CDS sequence.
*Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
*Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
Line 25: Line 28:
*<b>Check the primer is 20bp long and the product size is between 150-200bp.</b>
*<b>Check the primer is 20bp long and the product size is between 150-200bp.</b>


*Go to the UCSC genome browser website (http://genome.ucsc.edu/) and select the ‘BLAT’ tool.
*Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
*Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
*Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
*If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.
*If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.
Line 36: Line 39:
*Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221
*Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221


Questions? Contact Betül (betul.kacar@biology.gatech.edu)
➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)
 
===Primers for Kan===
 
*Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
*Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’
 
===Site-Directed Mutagenesis===
*[http://www.aidsreagent.org/pdfs/pet15b.pdf pET15b map]
*[http://www.chem.agilent.com/library/usermanuals/Public/210513.pdf QuikChange II STM Kit Protocol]
*[https://www.genomics.agilent.com/CollectionSubpage.aspx?PageType=Tool&SubPageType=ToolQCPD&PageID=15 QuikChange Primer Design (Agilent)]
 
=== LTE Assays===
araA Marker Test:
*Make sure to have: ''Hae''II Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
*[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAraMarker araA marker revertant test ]
 
===RT-PCR===
*[http://www.bio-rad.com/en-us/sku/170-9799-real-time-pcr-applications-guide BioRad Applications Guide]
*[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/PCR/real-time-pcr/real-time-pcr-reagents/one-step-real-time-rt-master-mix/power-sybr-rna-to-ct-1-step.html Green RNA to CT of AB]
*[http://products.invitrogen.com/ivgn/product/AM1560 mirVana mRNA Isolation Kit]
*A helpful [http://pathmicro.med.sc.edu/pcr/realtime-home.htm tutorial] by Margaret Hunt
*[http://dunham.gs.washington.edu/protocols.shtml Dunham lab] has some very helpful tips on microarray & genotyping studies
 
 
Compiled by Betul Kacar and Lily Tran in the year twothousandandthirteen.
Please contact betul AT gatech DOT edu for questions.

Revision as of 22:48, 27 August 2013

Tools

Gene/Protein Info

Protocols

Primer designing for gene expression profiling (bacteria)

➢Get the gene name (eg: MYD88)

  • Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
  • Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
  • Click on the link and go to the gene description page.
  • Scroll down and clink on the link to find the CDS, or the RefSeq.
  • Copy the CDS sequence.
  • Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
  • All the parameters for optimal primers are usually preset. Do not change anything.
  • Click “pick primers’.
  • When the selection of primers comes up, choose a pair that is closest to the 3’ end.
  • Check the primer is 20bp long and the product size is between 150-200bp.
  • Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
  • Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
  • If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.

➢ Order primers through Invitrogen:

  • Purification: Desalted
  • Starting Synthesis Scale: 25nmole
  • Ship Medium: Dry
  • Normalization: None
  • Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221

➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)

Primers for Kan

  • Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
  • Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’

Site-Directed Mutagenesis

LTE Assays

araA Marker Test:

  • Make sure to have: HaeII Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
  • araA marker revertant test

RT-PCR


Compiled by Betul Kacar and Lily Tran in the year twothousandandthirteen.
Please contact betul AT gatech DOT edu for questions.