Difference between revisions of "Primers for aiiA gene from Dr Fray.doc"

From OpenWetWare
Jump to: navigation, search
Line 26: Line 26:
We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers
We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers
<font color = yellow>Restriction Sites-</font colour><font color = red>Epitope tag</font color = red>-gene <font color = red>Degredation tag</font color = red>-Restriction Sites
<font color = yellow>Restriction Sites-</font colour><font color = red>Epitope tag</font color = red>-gene <font color = red>Degradation tag</font color = red>-Restriction Sites
  '''<font color = yellow>GAATTCGCGGCCGCATCTAGAG</font colour><font color = red>ATGGATTATAAAGATGATGATGATAAAGGT</font color = red>ATGACAGTAAAGAAGCTT 70
  '''<font color = orange>GAATTCGCGGCCGCATCTAGAG</font colour><font color = red>ATGGATTATAAAGATGATGATGATAAAGGT</font color = red>ATGACAGTAAAGAAGCTT 70

Revision as of 08:21, 28 October 2006

aiiA gene from Dr Fray



Degradation Tag + Stop codons


Epitope tag + start codon


Desired Sequence

We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers

Restriction Sites-Epitope tag-gene Degradation tag-Restriction Sites



  • 5’end = same as gene.
  • 3’end = reverse and complementary to gene