Primer Tm estimation methods

From OpenWetWare
Revision as of 02:01, 28 September 2009 by Jakob Suckale (talk | contribs)
Jump to navigationJump to search
example primer GC+AT=length Marmur rule Wallace rule Breslauer '86 SantaLucia '98
50/50 mixed: AGAGAGAGAGAGAGAGAGAG 10+10=20 60 52 46.3 47.7
50/50 separated: AAAAAAAAAAGGGGGGGGGG 10+10=20 60 52 66.0 52.7
ActB F: TTGCTGACAGGATGCAGAAG 10+10=20 60 52 60.1 52.4
ActB R: TGATCCACATCTGCTGGAAG 10+10=20 60 52 59.8 51.5
Tubb5 F: GATCGGTGCTAAGTTCTGGGA 11+10=21 64 54 61.5 53.7
Tubb5 R: AGGGACATACTTGCCACCTGT 11+10=21 64 54 60.8 55.1


melting temperature (Tm) estimation publications

  • Marmur formula: Tm = 4 x GC + 2 x AT
not recommended for more than 13nt; assumes 50mM monovalent cations
Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
  • Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
online tool using Wallace formula for oligos >13
  • Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae
Primer3 and Primer3Plus default maintained for backwards compatibility
  • SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
Primer3 recommended setting; also default settings of the NCBI's Primer BLAST


Conclusions

  • Marmur and Wallace formulae Tm estimation only take into account the number of GC and AT nucleotides. The position of the nucleotides in the primer is not considered (primer 1-4: same Tm; primer 5-6: longer, higher Tm).
  • Both Breslauer and SantaLucia thermodynamics factor in the nucleotide environment. GC rich islands lead to higher Tm estimates with the upwards trend being much more pronounced when the Breslauer calculations are used (primer 1, 2).