Primer Tm estimation methods
From OpenWetWare
example primer | Marmur rule | Wallace rule | Breslauer '86 | SantaLucia '98 |
---|---|---|---|---|
50/50 mixed: AGAGAGAGAGAGAGAGAGAG | 60 | 52 | 46.3 | 47.7 |
50/50 separated: AAAAAAAAAAGGGGGGGGGG | 60 | 52 | 66.0 | 52.7 |
ActB F: TTGCTGACAGGATGCAGAAG | 60 | 52 | 60.1 | 52.4 |
ActB R: TGATCCACATCTGCTGGAAG | 60 | 52 | 59.8 | 51.5 |
Tubb5 F: GATCGGTGCTAAGTTCTGGGA | 64 | 54 | 61.5 | 53.7 |
Tubb5 R: AGGGACATACTTGCCACCTGT | 64 | 54 | 60.8 | 55.1 |
- Marmur formula: Tm = 4 x GC + 2 x AT
- not recommended for more than 13nt; assumes 50mM monovalent cations
- Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
- Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
- Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
- online tool using Wallace formula for oligos >13
- Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae
- Primer3 and Primer3Plus default maintained for backwards compatibility
- SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
- Primer3 recommended setting; also default settings of the NCBI's Primer BLAST