Difference between revisions of "Primer Tm estimation methods"

From OpenWetWare
Jump to: navigation, search
(ficticous primer)
Line 7: Line 7:
! style="background:lightgrey"|Breslauer '86
! style="background:lightgrey"|Breslauer '86
! style="background:lightgrey"|SantaLucia '98
! style="background:lightgrey"|SantaLucia '98
| 60
| 52
| 46.3
| 47.7
| 60
| 52
| 66.0
| 52.7
Line 41: Line 53:
: [http://www.basic.northwestern.edu/biotools/oligocalc.html online tool] using Wallace formula for oligos >13
: [http://www.basic.northwestern.edu/biotools/oligocalc.html online tool] using Wallace formula for oligos >13
* Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746
* Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746 combined with Schildkraut et al. 1965 salt correction formulae
: [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility
: [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility
* SantaLucia 1998, DOI:10.1073/pnas.95.4.1460
* SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 thermodynamics & salt correction
: Primer3 recommended setting; also default settings of the NCBI's [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Primer BLAST]
: Primer3 recommended setting; also default settings of the NCBI's [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Primer BLAST]

Revision as of 00:45, 28 September 2009

Comparison of primer Tm estimation methods
example primer Marmur rule Wallace rule Breslauer '86 SantaLucia '98
50/50 mixed: AGAGAGAGAGAGAGAGAGAG 60 52 46.3 47.7
50/50 separated: AAAAAAAAAAGGGGGGGGGG 60 52 66.0 52.7
Tubb5 F: GATCGGTGCTAAGTTCTGGGA 64 54 61.5 53.7
Tubb5 R: AGGGACATACTTGCCACCTGT 64 54 60.8 55.1
  • Marmur formula: Tm = 4 x GC + 2 x AT
not recommended for more than 13nt; assumes 50mM monovalent cations
Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
  • Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
online tool using Wallace formula for oligos >13
  • Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746 combined with Schildkraut et al. 1965 salt correction formulae
Primer3 and Primer3Plus default maintained for backwards compatibility
  • SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 thermodynamics & salt correction
Primer3 recommended setting; also default settings of the NCBI's Primer BLAST