Difference between revisions of "OpenWetWare:File Import Examples (PDF,DOC, and XLS)"

From OpenWetWare
Jump to: navigation, search
(Google Doc Viewer)
(Google Doc Viewer)
Line 96: Line 96:
{{#widget:Google Documents
{{#widget:Google Documents

Revision as of 06:08, 12 April 2009

PDF Files


  • Name: Adobe PDF File
  • File Suffix: PDF
  • OWW Action: Download
  • Location: Uploaded by OWW member to OpenWetWare

Example Syntax:

[[media:OSX Security Paper.pdf | OSX Security Paper.pdf]]

Live Example:

OSX Security Paper.pdf

View Info

  • Name: Adobe PDF File
  • File Suffix: PDF
  • OWW Action: View
  • File Location: File Uploaded by OWW member to OpenWetWare

Example Syntax:

[[image:OSX Security Paper.pdf] | OSX Security Paper.pdf]]

Live Example:

[[image:OSX Security Paper.pdf] | OSX Security Paper.pdf]]

Word Doc Files


  • Name:Microsoft Word Document File
  • File Suffix: DOC
  • OWW Action: Download
  • File Location: File Uploaded by OWW member to OpenWetWare

Example Syntax:

[[media:Streptomyces_DNA_Marker-Lambda_Ladder.doc | Streptomyces_DNA_Marker-Lambda_Ladder.doc]]

Live Example:


View Info

  • Name:Microsoft Word Document File
  • File Suffix: DOC
  • OWW Action: View
  • File Location: File Uploaded by OWW member to OpenWetWare

Example Syntax:


Live Example:

File:Streptomyces DNA Marker-Lambda Ladder.doc

Google Doc Link

  • Name:Microsoft Word Document File
  • File Suffix: DOC
  • OWW Action: External File Link to Google
  • File Location: File Uploaded to Google Documents
  • Example Syntax: [http://docs.google.com/Doc?id=dzcjgm2_12fhc3wkd2 Streptomyces_DNA_Marker-Lambda_Ladder.doc]
  • Live Example: Streptomyces_DNA_Marker-Lambda_Ladder.doc

Google Doc Viewer

  • Name:Microsoft Word Document File
  • File Suffix: DOC
  • OWW Action: Embedded Google Doc Viewer
  • File Location: File Uploaded to Google Documents
  • Google Document URL: returned when document is published
  • Example Google Document URL: http://docs.google.com/Doc?id=dzcjgm2_12fhc3wkd2
  • Google Document ID: contained within Google Document URL (save as "Key=")
  • Viewer Area (in pixels): width=500 height=300
  • Example Google Document ID id=dzcjgm2_12fhc3wkd2

Example Syntax:

{{#widget:Google Documents |key=dzcjgm2_12fhc3wkd2 |width=500 |height=300 }}

Live Example:

{{#widget:Google Documents |key=dzcjgm2_12fhc3wkd2 |width=500 |height=300 }}

{{#widget:Google Documents |key=pWN8P5GI2cBX0BwZCgKkzRg |width=500 |height=300 }}

Excel Spreadsheet XLS Files


  • Name:Microsoft Excel Document File
  • File Suffix: XLS
  • OWW Action: Download
  • File Location: File Uploaded by OWW member to OpenWetWare

Example Syntax:


Live Example:


View Info

  • Name:Microsoft Excel Document File
  • File Suffix: XLS
  • OWW Action: View
  • File Location: File Uploaded by OWW member to OpenWetWare

Example Syntax:


Live Example:


Google Doc Link

  • Name:Microsoft Excel Document File
  • File Suffix: XLS
  • OWW Action: External File Link to Google
  • File Location: File Uploaded to Google Documents
  • Example Syntax: [http://spreadsheets.google.com/pub?key=pPNCEiE71Bq1I759bMAFhTg JCATutorial-BiobrickCalculatorExample.xls]
  • Live Example: JCATutorial-BiobrickCalculatorExample.xls

Google Doc Viewer

  • Name:Microsoft Excel Document File
  • File Suffix: XLS
  • OWW Action: Embedded Google Doc Viewer
  • File Location: File Uploaded to Google Documents
  • Google Document URL: returned when document is published
  • Example Google Document URL: http://docs.google.com/Doc?id=dzcjgm2_12fhc3wkd2
  • Google Document ID: contained within Google Document URL (save as "Key=")
  • Viewer Area (in pixels): width=500 height=300
  • Example Google Document ID id=dzcjgm2_12fhc3wkd2

Example Syntax:

{{#widget:Google Spreadsheet |key=pPNCEiE71Bq1I759bMAFhTg |width=500 |height=300 }}

Live Example:

{{#widget:Google Spreadsheet |key=pPNCEiE71Bq1I759bMAFhTg |width=500 |height=300 }}

OWW Excel HTML Convert

  • Name:Microsoft Excel Document File
  • File Suffix: XLS
  • OWW Action:
  • OWW Converter URL: (TBD)
  • File Location: File Uploaded to by OWW member to OpenWetWare.org

Live Example:

<html> <style> table.excel { border-style:ridge; border-width:1; border-collapse:collapse; font-family:sans-serif; font-size:12px; } table.excel thead th, table.excel tbody th { background:#CCCCCC; border-style:ridge; border-width:1; text-align: center; vertical-align:bottom; } table.excel tbody th { text-align:center; width:20px; } table.excel tbody td { vertical-align:bottom; } table.excel tbody td {

   padding: 0 3px;

border: 1px solid #EEEEEE; } </style>

<table class="excel" cellspacing=0><thead> <tr> <th>&nbsp</th> <th style="width:16.648435790855px;">A</th> <th style="width:16.648435790855px;">B</th> <th style="width:16.648435790855px;">C</th> <th style="width:56.005250492234px;">D</th> <th style="width:44.804200393787px;">E</th> <th style="width:296.82782760884px;">F</th> <th style="width:56.005250492234px;">G</th> <th style="width:56.005250492234px;">H</th> <th style="width:56.005250492234px;">I</th> <th style="width:56.005250492234px;">J</th> <th style="width:33.60315029534px;">K</th> <th style="width:58.083570334719px;">L</th> <th style="width:64.427915117042px;">M</th> <th style="width:56.005250492234px;">N</th> <th style="width:56.005250492234px;">O</th> <th style="width:56.005250492234px;">P</th> <th style="width:56.005250492234px;">Q</th> <th style="width:56.005250492234px;">R</th> <th style="width:44.804200393787px;">S</th></tr></thead> <tbody>

<tr style="height:17px;"> <th>1</th> <td style="font-family:Webdings;font-size:8px;color:#FFFFFF;"><nobr></nobr></td> <td style="font-family:Webdings;font-size:8px;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:8px;color:#000000;font-weight:bold;"><nobr>Plasmid Calculator:</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>2</th> <td style="font-family:Webdings;font-size:8px;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>vector:</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>part:</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>3057</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>bp</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:19px;"> <th>3</th> <td style="font-family:Webdings;font-size:8px;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style=""><nobr>[FRT][CmR][FRT] in Regular BBa vector</nobr></td> <td style=""><nobr>ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccactagaggaagttcctatactttTtagagaataggaacttctactagtagcggccgctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcat</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX002</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#000000;"><nobr>3057</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>4</th> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:8px;background-color:#000000;color:#FFFF00;font-weight:bold;"><nobr>g</nobr></td> <td style="font-family:Arial;font-size:8px;background-color:#000000;color:#00FF00;font-weight:bold;"><nobr>g</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Vector</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Part</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Description</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Sequence</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Lefty</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Righty</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Size</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Creator</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Note</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Registry #</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>5</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Blank</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>&nbsp;</nobr></td> <td style=""><nobr>Blank</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>6</th> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>g</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>g</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Bca1010</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[FRT]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagaggaagttcctatactttTtagagaataggaacttcta</nobr></td> <td style=""><nobr>Bca1010</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>42</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>J61020</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>7</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>g</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Bca1016</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[CmR]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca</nobr></td> <td style=""><nobr>Bca1016</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>902</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>J61000</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>8</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>r0040</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[Ptet]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacta</nobr></td> <td style=""><nobr>r0040</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>62</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>MIT</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>r0040</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>9</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1AK3</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>b0015</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[TT]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatata</nobr></td> <td style=""><nobr>b0015</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>137</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>MIT</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>b0015</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>10</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1AK3</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>b0034</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[RBS]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagagaaagaggagaaata</nobr></td> <td style=""><nobr>b0034</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>20</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>MIT</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>b0034</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>11</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>b0032</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[RBS]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagagtcacacaggaaagta</nobr></td> <td style=""><nobr>b0032</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>21</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>MIT</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>b0032</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>12</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>e0040</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>[GFP]</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>ctagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataata</nobr></td> <td style=""><nobr>e0040</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>726</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>MIT</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>Basic</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>e0040</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>


<tr style="height:17px;"> <th>14</th> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>15</th> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>16</th> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>17</th> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>g</nobr></td> <td style=""><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX001</nobr></td> <td style=""><nobr>[FRT][CmR]</nobr></td> <td style=""><nobr>ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Bca1010</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Bca1016</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>944</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style=""><nobr>Composite</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>18</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>g</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1AK3</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX002</nobr></td> <td style=""><nobr>[FRT][CmR][FRT]</nobr></td> <td style=""><nobr>ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccactagaggaagttcctatactttTtagagaataggaacttcta</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX001</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>Bca1010</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>986</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style=""><nobr>Composite</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>19</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>g</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX003</nobr></td> <td style=""><nobr>[FRT][CmR]</nobr></td> <td style=""><nobr>ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>blank</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX001</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>944</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style=""><nobr>Composite</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>20</th> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>g</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#FFFF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Webdings;font-size:8px;background-color:#000000;color:#00FF00;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>EX004</nobr></td> <td style=""><nobr>[RBS][GFP]</nobr></td> <td style=""><nobr>ctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataata</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>b0034</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#0000FF;"><nobr>e0040</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>746</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>JCA</nobr></td> <td style=""><nobr>Composite</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>21</th> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#33CCCC;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>22</th> <td style="font-family:Courier New;font-size:8px;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>pSB1A2</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr> in Regular BBa vector</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>ctagtagcggccgctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcat</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr> </nobr></td> <td style="font-family:Courier New;font-size:8px;color:#33CCCC;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>23</th> <td style="font-family:Courier New;font-size:8px;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#FF0000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>pSB1AK3</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr> in KanR/AmpR BBa vector</nobr></td> <td style="font-family:Courier New;font-size:8px;background-color:#000000;color:#FFFFFF;"><nobr>ctagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagctcgagtcccgtcaagtcagcgtaatgctctgccagtgttacaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctggagcaagacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaacatcagagattttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaaggatcagctcgagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgctt</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr> </nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Courier New;font-size:8px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr>

<tr style="height:17px;"> <th>24</th> <td style="font-family:Arial;font-size:10px;color:#FFFFFF;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td> <td style="font-family:Arial;font-size:10px;color:#000000;"><nobr>&nbsp;</nobr></td></tr> </tbody></table> </html>

OWW Excel CSV Convert

  • Name:Microsoft Excel Comma Separated Value (CSV) File
  • File Suffix: CSV
  • OWW Action: [[Special:Excelupload]]
  • OWW Converter URL: [[Special:Excelupload]]
  • File Location: CSV File Uploaded to by OWW member to OpenWetWare.org

Live Example:

Plasmid Calculator:
vector: part: 3057 bp
[FRT][CmR][FRT] in Regular BBa vector ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccactagaggaagttcctatactttTtagagaataggaacttctactagtagcggccgctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcat pSB1A2 EX002 3057
g g Vector Part Description Sequence Lefty Righty Size Creator Note Registry #
pSB1A2 Blank Blank 0 Basic
g g pSB1A2 Bca1010 [FRT] ctagaggaagttcctatactttTtagagaataggaacttcta Bca1010 42 JCA Basic J61020
g pSB1A2 Bca1016 [CmR] ctagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca Bca1016 902 JCA Basic J61000
pSB1A2 r0040 [Ptet] ctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacta r0040 62 MIT Basic r0040
pSB1AK3 b0015 [TT] ctagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatata b0015 137 MIT Basic b0015
pSB1AK3 b0034 [RBS] ctagagaaagaggagaaata b0034 20 MIT Basic b0034
pSB1A2 b0032 [RBS] ctagagtcacacaggaaagta b0032 21 MIT Basic b0032
pSB1A2 e0040 [GFP] ctagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataata e0040 726 MIT Basic e0040
g pSB1A2 EX001 [FRT][CmR] ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca Bca1010 Bca1016 944 JCA Composite
g pSB1AK3 EX002 [FRT][CmR][FRT] ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgccactagaggaagttcctatactttTtagagaataggaacttcta EX001 Bca1010 986 JCA Composite
g pSB1A2 EX003 [FRT][CmR] ctagaggaagttcctatactttTtagagaataggaacttctactagaggaataggaacttcatttaaatggcgcgccttacgccccgccctgccactcatcgcagtactgttgtattcattaagcatctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgtaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacaactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtaggcgcgcca blank EX001 944 JCA Composite
g pSB1A2 EX004 [RBS][GFP] ctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataata b0034 e0040 746 JCA Composite
pSB1A2 in Regular BBa vector ctagtagcggccgctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcat
pSB1AK3 in KanR/AmpR BBa vector ctagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagctcgagtcccgtcaagtcagcgtaatgctctgccagtgttacaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctggagcaagacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaacatcagagattttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaaggatcagctcgagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgctt