Difference between revisions of "Mazel/pSW8197"

From OpenWetWare
Jump to: navigation, search
 
Line 1: Line 1:
LOCUS      pSW8197        3490 bp    DNA    circular SYN 02-MAR-2009
+
{{Template:Mazel}}
 +
<br><br>
 +
 
 +
LOCUS      pSW8197        3490 bp    <br>
 
DEFINITION  Ligation of pMP7 = pSW23T-ccdB-xbaI-sacI* into pSW29T*
 
DEFINITION  Ligation of pMP7 = pSW23T-ccdB-xbaI-sacI* into pSW29T*
 
ACCESSION  alternate name pMP15
 
ACCESSION  alternate name pMP15

Latest revision as of 06:53, 19 November 2010

<html><style type="text/css">

  1. bandeau {

padding: 2px; background-color: #200B80; width: 764px; font-size: 14px; font-family: trebuchet ms; text-align: center; font-weight:bold; }

  1. bandeau a:link {color: #ffffff;}
  2. bandeau a:active {color:#ffffff;}
  3. bandeau a:visited {color: #ffffff;}
  4. bandeau a:hover {

color: #FF0000; text-decoration: none; }

  1. main{

padding: 5px; width: 750px; height: 340px; border: 4px solid #200B80; font-size: 14px; text-align: center; background-image: url('/images/3/3a/Mazel_background.png'); }

  1. leftText{

margin-top: 50px; font-size: 20px; width: 350px; left: 0px; text-align: center; }

  1. news{

margin:-150px 0px 0px 53%; font-size: 14px; font-weight: bold; width: 350px; right: 0px; text-align: center; }

  1. map{

margin: -240px 0px 0px 50%; } .selflink{ color: #ffffff; font-weight: normal; } </style> <meta name="keywords" content="BGP, lab, laboratory, BGP lab, Bacterial Genome Plasticity, Super, Integrons, superintegron, bacterial, genome, plasticity, gene, institut Pasteur, institute, vibrio, cholerae, gene cassette, antibiotics, resistance" /> </html>


Bacterial Genome Plasticity

Home     Research     Publications     Plasmids / Strains     Protocols     Lab Members     Contact     Internal     Links    



LOCUS pSW8197 3490 bp
DEFINITION Ligation of pMP7 = pSW23T-ccdB-xbaI-sacI* into pSW29T* ACCESSION alternate name pMP15 KEYWORDS . SOURCE Unknown.

 ORGANISM  Unknown
           Unclassified.

REFERENCE 1 (bases 1 to 3490)

 AUTHORS   Marie-Eve VAL
 JOURNAL   Notebook 

COMMENT SECID/File created by Clone Manager, Scientific & Educational Software COMMENT SECNOTES|Author:: Marie-Eve VAL

           Date:: 02 Mar 2009
           Notebook:: 
           Vector molecule:  pSW29T*
              Fragment ends: SacI and XbaI
              Fragment size: 1930
           Insert molecule:  pMP7 = pSW23T-ccdB-xbaI-sacI*
              Fragment ends: XbaI and SacI
              Fragment size: 1560

FEATURES Location/Qualifiers

    misc_feature    46..302
                    /gene="oriT-RP4"
                    /SECDrawAs="Region"
    misc_signal     329..359
                    /gene="MCS'"
                    /SECDrawAs="Label"
    CDS             complement (392..1321)
                    /gene="araC"
                    /SECDrawAs="Gene"
    CDS             1609..1914
                    /gene="ccdB"
                    /SECDrawAs="Gene"
    misc_feature    1979..2405
                    /gene="oriVR6K"
                    /SECDrawAs="Region"
    CDS             complement (2485..3279)
                    /gene="aph"
                    /product="KanR"
                    /SECDrawAs="Gene"


PSW8197.jpg

>pSW8197

CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTAC CAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTT TTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGG TTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATA GGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTA TTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG CGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGAT CCACTAGTTCTAGAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAA CTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGAAACTCGC TCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGAGAAATAGAGTTGA TCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTAGT GCTCAAAAGCAGCTTCGCCTGACTAATGCGTTGGTCCTCGCGCCAGCTTA AGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGC CAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGC TCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTT CATCCGGGCGAAAGAAACCCGTATTGGCAAATATTGACGGCCAGTTAAGC CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCA TTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA ACAGCAAAATATCACCCGGTCGGCAGACAAATTCTCGTCCCTGATTTTTC ACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCG TTAAACCCGCCACCAGATGGGCGTTAAACGAGTATCCCGGCAGCAGGGGA TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAGAAGA AACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT GGCTCTTCTCGCTAACCCAACCGGTAACCCCGCTTATTAAAAGCATTCTG TAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGA GTGAAACGATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTAT CGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCC GTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATG ACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGC TGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGT TCTGGGGAATATAAGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAT TGCGCGCAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAAT TGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGT TGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTA TATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAG CTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGT TCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGA AACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCA GATCCTCTACGCCGGACGCATCGTGGCCGGATCAGATCTGATATCGTCGC AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTT CTAGGCACCAATAACTGCCTTAAAAAAACTGCAGTCAGAAGAACTCGTCA AGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTA AAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATAT CACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGG CCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGG CAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATCC GCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCT TCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGC TCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGAT CAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCG GCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAA TAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGC AAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGG AGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCG CCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCT GTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAA CCTGCGTGCAATCCATCTTGTTCAATCATTTTAGCTTCCTTAGCTCCTGA AAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTAT GGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAA AAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTA TTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCG