
From OpenWetWare
Revision as of 17:28, 9 October 2006 by Tk (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Sequencing primers for pRML1, pRML2:

  • T3 for pRML1
  • T7 for pRML2

For both pRML1 & 2:

  • attgtctcatgagcggatac,ampR-F
  • ggtcacgctgcgcgtaacc,F1-F (works on pRML1, missing region on pRML2)
  • atggaaaaacgccagcaacg,322ori-R

Construction primers:

  • pRML1 (Left YAC arm)
    • biobrick right end, binding site for Cen4 sequence
    • binds with stutter
  • pRML2-F (Right YAC arm)
    • biobrick left end, ARSH4 binding site
    • binds with stutter


New primers for pRML1 9/17/06



ttgcctgggctttggacgtc,TKR2 (46860)

cagataccgcaccgtattgg,TK2 (47060)

caccacacaacaccgcctcg,TKR3 (47570)

tggtcgaacgcagacgcgtg,TK3 (47760)

cacaggtagttctggtccattg,TRP1 (460) pSH63 AF298789

agcatcggaatctagagcac,TRPR1 (550)

ggtgttgatgtaagcggagg,TRP2 (1060)

ctatttcttagcatttttgacg,TRPR2 (1130)

acatcaacaccaataacgcc,YAC4R1 (9710) pYAC4

gcttacattt tatgttagct gg,YAC4-1 (9640)

agcgttgcct catcaatgcg,YAC4-2 (10370)



September 24 primers for pRML1





Primers 9/17/06

aaatt gaagctctaa tttgtgag,URA1 (3200) DQ882849

ggtagagggtgaacgttacag,URA1R (3300)


September 24 primers:



Final sequence, pRML1=

>pRML1 9742 bp ggatccatatgactagtgatcctctagagtcgatcgacctgcaggcatgcctgcaggtcg aggcgataagcttcatttttagataaaatttattaatcatcattaatttcttgaaaaaca ttttatttattgatcttttataacaaaaaacccttctaaaagtttatttttgaatgaaaa acttataaaaatttatgaaaactacaaaaaataaaatttttaattaaaataattttgata agaacttcaatctttgactagcttagtcatttttgagatttaattaatattttatgttta ttcatatataaactattcaaaatattatagaatttaaacattttaacatcttaatcattc ataaataactaaaaatcaaagtattacattcaataaataacttttactcaatgtcaaaga aattattggggttggggttggggttggggttggggttggggttggggttggggttggggt tggggttggggttggggttggggttggggttggggttggggttggggttggggttggggt tggggttggggttggggttggggttggggttggggttggggttggggttggggttggggt tggggttggggttggggttgggggttggggttggggttggggttggggttggggttgggg ttggggttggggttggggttggggttggggtctgcctcgcgcggaaattcatcgatttcg aagctagctcgcgagtcgaccgcggccgcagatctgaattccctttagtgagggttaatt tacgtagcgatgataagctgtcaaacatgagctgggccattctcatgaagaatatcttga atttattgtcatattactagctagttggtgtggaagtcctaatatcggtgatcaatatag tggttgacatgctggctagtcaacattgagccttttgatcatgcaaatatattacggtat tttacaatcaaatatcaaacttaactattgactttataacttatttaggtggtaacattc ttataaaaaagaaaaaaattactgcaaaacagtactagcttttaacttgtatcctaggtt atctatgctgtctcaccatagagaatattacctatttcagaatgtatgtccatgattcgc cgggtaaatacatataatacacaaatctggcttaataaagtctataatatatctcataaa gaagtgctaaattggctagtgctatatatttttaagaaaatttcttttgactaagtccat atcgactttgtaaaagttcacattagcatacatatattacacgagccagaaatagtaact tttgcctaaatcacaaattgcaaaawttaattgcttgcaaaaggtcacatgcttataatc aacttttttaaaaatttaaaatacttttttattttttatttttaaacataaatgaaataa tttatttattgtttatgattaccgaaacataaaacctgctcaagaaaaagaaactgtttt gtccttggaaaaaaagcactacctaggagcggccaaaatgccgaggctttcatagcttaa actctttacagaaaataggcattatagatcagttcgagttttcttattcttccttccggt tttatcgtcacagttttacagtaaataagtatcacctcttagagttcgacccggggtttt ttctccttgacgttaaagtatagaggtatattaacaattttttgttgatacttttattac atttgaataagaagtaatacaaaccgaaaatgttgaaagtattagttaaagtggttatgc agtttttgcatttatatatctgttaatagatcaaaaatcatcgcttcgctgattaattac cccagaaataaggctaaaaaactaatcgcattatcatcctatggttgttaatttgattcg ttcatttgaaggtttgtggggccaggttactgccaatttttcctcttcataaccataaaa gctagtattgtagaatctttattgttcggagcagtgcggcgcgaggcacatctgcgtttc aggaacgcgaccggtgaagacgaggacgcacggaggagagtcttccttcggagggctgtc acccgctcggcggcttctaatccgtactatgagataagcaagtatcatctcatttcatta cctgaagtcgagtaaacagaaaatccaattgttgatgaacctcaatgacttagaactatc tatcggcagatcatataaagaggatttagaattaattccacatgttaaaatagtgaagga gcatgttcggcacacagtggaccgaacgtggggtaagtgcactagggtccggttaaacgg atctcgcattgatgaggcaacgctaattatcaacatatagattgttatctatctgcatga acacgaaatctttacttgacgacttgaggctgatggtgtttatgcaaagaaaccactgtg tttaatatgtgtcactgtttgatattactgtcagcgtagaagataatagtaaaagcggtt aataagtgtatttgagataagtgtgataaagtttttacagcgaaaagacgataaatacaa gaaaatgattacgaggatacggagagaggtatgtacatgtgtatttatatactaagctgc cggcggttgtttgcaagaccgagaaaaggctagcaagaatcgggtcattgtagcgtatgc gcctgtgaacattctcttcaacaagtttgattccattgcggtgaaatggtaaaagtcaac cccctgcgatgtatattttcctgtacaatcaatcaaaaagccaaatgatttagcattatc tttacatcttgttattttacagattttatgtttagatcttttatgcttgcttttcaaaag gcctgcaggcaagtgcacaaacaatacttaaataaatactactcagtaataacctatttc ttagcatttttgacgaaatttgctattttgttagagtcttttacaccatttgtctccaca cctccgcttacatcaacaccaataacgccatttaatctaagcgcatcaccaacattttct ggcgtcagtccaccagctaacataaaatgtaagctttcggggctctcttgccttccaacc cagtcagaaatcgagttccaatccaaaagttcacctgtcccacctgcttctgaatcaaac aagggaataaacgaatgaggtttctgtgaagctgcactgagtagtatgttgcagtctttt ggaaatacgagtcttttaataactggcaaaccgaggaactcttggtattcttgccacgac tcatctccatgcagttggacgatatcaatgccgtaatcattgaccagagccaaaacatcc tccttaggttgattacgaaacacgccaaccaagtatttcggagtgcctgaactattttta tatgcttttacaagacttgaaattttccttgcaataaccgggtcaattgttctctttcta ttgggcacacatataatacccagcaagtcagcatcggaatctagagcacattctgcggcc tctgtgctctgcaagccgcaaactttcaccaatggaccagaactacctgtgaaattaata acagacatactccaagctgcctttgtgtgcttaatcacgtatactcacgtgctcaatagt caccaatgccctccctcttggccctctccttttcttttttcgaccgaattaattcttaat cggcaaaaaaagaaaagctccggatcaagattgtacgtaaggtgacaagctatttttcaa taaagaatatcttccactactgccatctggcgtcataactgcaaagtacacatatattac gatgctgttctattaaatgcttcctatattatatatatagtaatgtcgttaaccgttgat ttttactgattggtctctgccgtgcgggtgagcggcgcgtccagacgggcgggtgcacgt ttctttttctgaccatttccctgtcagctcttttagatcggggctgccgtttgaaaagtt ttatcatcgccagacatgccataaggaatatctccaccgcctctaactgtccctaactcg gtctctttcttataactaccattactcagtgttgagagattggtagaaatatacgcgtat acgttcattcaagacttattttcagccagtaatattccctactcctcttccgttttcaga atagagatggaccagccaaggacccattcaggacccacgacggccagcaatcctgccccc agctccaccaactcgtcatctgctcccagcgcgactaattcaaagcaggaaagatccaca ggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagca ggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaatt gcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatgga cgataattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcat gataataatggtttcttagaatttaattcgaacacgcagatgcagtcggggcggcgcggt cccaggtccacttcgcatattaaggtgacgcgtgtggcctcgaataccgagcgaccctgc agcgacccgcttaacagcgtcaacagcgtgccgcagatctctcttgcgagatgatcccgc attttcttgaaagctttgcagaggctagcagaattaccctccacgttgattgtctgcgag gcaagaatgatcatcaccgtagtgagagtgcgttcaaggctcttgcggttgccataagag aagccacctcgcccaatggtaccaacgatgttccctccaccaaaggtgttcttatgtagt gacaccgattatttaaagctgcagcatacgatatatatacatgtgtatatatgtatacct atgaatgtcagtaagtatgtatacgaacagtatgatactgaagatgacaaggtaatgcat cattctatacgtgtcattctgaacgaggcgcgctttccttttttctttttgctttttctt tttttttctcttgaactcgagaaaaaaaatataaaagagatggaggaacgggaaaaagtt agttgtggtgataggtggcaagtggtattccgtaagaacaacaagaaaagcatttcatat tatggctgaactgagcgaacaagtgcaaaatttaagcatcaacgacaacaacgagaatgg ttatgttcctcctcacttaagaggaaaaccaagaagtgccagaaataacagtagcaacta caataacaacaacggcggctacaacggtggccgtggcggtggcagcttctttagcaacaa ccgtcgtggtggttacggcaacggtggtttcttcggtggaaacaacggtggcagcagatc ttggtggcgtgaaactcccgcacctcttcggccagcgccttgtagaagcgcgtatggctt cgtacccctgccatcaacacgcgtctgcgttcgaccaggctgcgcgttctcgcggccata acaaccgacgtacggcgttgcgccctcgccggcaacaaaaagccacggaagtccgcctgg agcagaaaatgcccacgctactgcgggtttatatagacggtccccacgggatggggaaaa ccaccaccacgcaactgctggtggccctgggttcgcgcgacgatatcgtctacgtacccg agccgatgacttactggcgggtgttgggggcttccgagacaatcgcgaacatctacacca cacaacaccgcctcgaccagggtgagatatcggccggggacgcggcggtggtaatgacaa gcgcccagataacaatgggcatgccttatgccgtgaccgacgccgttctggctcctcata tcgggggggaggctgggagctcacatgccccgcccccggccctcaccctcatcttcgacc gccatcccatcgccgccctcctgtgctacccggccgcgcgataccttatgggcagcatga ccccccaggccgtgctggcgttcgtggccctcatcccgccgaccttgcccggcacaaaca tcgtgttgggggcccttccggaggacagacacatcgaccgcctggccaaacgccagcgcc ccggcgagcggcttgacctggctatgctggccgcgattcgccgcgtttatgggctgcttg ccaatacggtgcggtatctgcagggcggcgggtcgtggcgggaggattggggacagcttt cgggggcggccgtgccgccccagggtgccgagccccagagcaacgcgggcccacgacccc atatcggggacacgttatttaccctgtttcgggcccccgagttgctggcccccaacggcg acctgtataacgtgtttgcctgggctttggacgtcttggccaaacgcctccgtcccatgc acgtctttatcctggattacgaccaatcgcccgccggctgccgggacgccctgctgcaac ttacctccgggatggtccagacccacgtcaccaccccaggctccataccgacgatctgcg acctggcgcgcacgtttgcccgggagatgggggaggctaactgaaacacggaaggagaca ataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgt tgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgatacccc accgagaccccattgggaccaatacgcccgcgtttcttccttttccccaccccaaccccc aagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaagccctgccatagc cacgggccccgtgggttagggacggggtcccccatggggaatggtttatggttcgtgggg gttattattttgggcgttgcgtggggtcaggtccacgactggactgagcagacagaccca tggtttttggatggcctgggcatggaccgcatgtactggcgcgacacgaacaccgggcgt ctgtggctgccaaacacccccgacccccaaaaaccaccgcgcggatttctggcgccgccg gacgaactaaacctgactacggcatctctgccccttcttcgctggtacgaggagcgcttt tgttttgtattggtcaccacggccgagtttccgcgggaccccggccagctgctttacatc ccgaagacctacctgctcggccggcccccgaacgcgagcctgcccgcccccaccacggtc gagccgaccgcccagcctcccccctcggtcgccccccttaagggtctcttgcacaatcca gccgcctccgtgttgctgcgttcccgggcctgggtaacgttttcggccgtccctgacccc gaggccctgacgttcccgcggggagacaacgtggcgacggcgagccacccgagcgggccg cgtgatacaccgcccccccgaccgccggttggggcccggcggcacccgacgacggagctg gacatcacgcacctgcacaacgcgtccacgacctggttggccacccggggcctgttgaga tccccaggtaggtacgtgtatttctccccgtcggcctcgacgtggcccgtgggcatctgg acgacgggggagctggtgctcgggtgcgatgccgcgctggtgcgcgcgcgctacgggcgg gaattaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaa atacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatat tgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcg gcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaa gatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcctt gagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgt ggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactat tctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatg acagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaactta cttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggat catgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgag cgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaa ctacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgca ggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgt atcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatc gctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatat atactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctt tttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgc ttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacca actctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttcta gtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgct ctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttg gactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgc acacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcta tgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagg gtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagt cctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggggg cggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctgg ccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattacc gcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtg agcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatt tcacaccgcatacggtacccgg

Final sequence, pRML2

>pRML2 5180 bp ggatcctctagagtcgatcgacctgcaggcatgcctgcaggtcgaggcgataagcttcat ttttagataaaatttattaatcatcattaatttcttgaaaaacattttatttattgatct tttataacaaaaaacccttctaaaagtttatttttgaatgaaaaacttataaaaatttat gaaaactacaaaaaataaaatttttaattaaaataattttgataagaacttcaatctttg actagcttagtcatttttgagatttaattaatattttatgtttattcatatataaactat tcaaaatattatagaatttaaacattttaacatcttaatcattcataaataactaaaaat caaagtattacattcaataaataacttttactcaatgtcaaagaaattattggggttggg gttggggttggggttggggttggggttggggttggggttggggttggggttggggttggg gttggggttggggttggggttggggttggggttggggttggggttggggttggggttggg gttggggttggggttggggttggggttggggttggggttggggttggggttggggttggg gttggggttgggggttggggttggggttggggttggggttggggttggggttggggttgg ggttggggttggggttggggtctgcctcgcgcggaaattcatcgatttcgaagctagctc gcgagtcgaccgccggcgcagatctgaattcgatgtacccaattcgccctatagtgagtc gtattacgcgcgtcgacggtatcgggggatcgccaacaaatactaccttttatcttgctc ttcctgctctcaggtattaatgccgaattgtttcatcttgtctgtgtagaagaccacaca cgaaaatcctgtgattttacattttacttatcgttaatcgaatgtatatctatttaatct gcttttcttgtctaataaatatatatgtaaagtacgctttttgttgaaattttttaaacc tttgtttatttttttttcttcattccgtaactcttctaccttctttatttactttctaaa atccaaatacaaaacataaaaataaataaacacagagtaaattcccaaattattccatca ttaaaagatacgaggcgcgtgtaagttacaggcaagcgatccgtcgataagctttttctt tccaattttttttttttcgtcattataaaaatcattacgaccgagattcccgggtaataa ctgatataattaaattgaagctctaatttgtgagtttagtatacatgcatttacttataa tacagttttttagttttgctggccgcatcttctcaaatatgcttcccagcctgcttttct gtaacgttcaccctctaccttagcatcccttccctttgcaaatagtcctcttccaacaat aataatgtcagatcctgtagagaccacatcatccacggttctatactgttgacccaatgc gtctcccttgtcatctaaacccacaccgggtgtcataatcaaccaatcgtaaccttcatc tcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgc aatgtcaacagtacccttagtatattctccagtagatagggagcccttgcatgacaattc tgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaacc gctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctat tctgtatacacccgcagagtactgcaatttgactgtattaccaatgtcagcaaattttct gtcttcgaagagtaaaaaattgtacttggcggataatgcctttagcggcttaactgtgcc ctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacc taatgcttcaactaactccagtaattccttggtggtacgaacatccaatgaagcacacaa gtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacaggactaggatgagt agcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcctgcaggtttt tgttctgtgcagttgggttaagaatactgggcaatttcatgtttcttcaacactacatat gcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcggagat taccgaatcaaaaaaatttcaaggaaaccgaaatcaaaaaaaagaataaaaaaaaaatga tgaattgaaaagcttgatatcgaattaattcgcgctcactggccgtcgttttacaacgtc gtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcg ccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcc tgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggtta cgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcc cttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctt tagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatg gttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcca cgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtct attcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctga tttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcac ttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatat gtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagag tatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcc tgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgc acgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccc cgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatc ccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgactt ggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaatt atgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgat cggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcct tgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgat gcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagc ttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcg ctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtc tcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatcta cacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgc ctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattga tttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcat gaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagat caaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaa accaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaa ggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtt aggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgtt accagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgata gttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagctt ggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggaga gcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcg ccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaa aaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat gttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagc tgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgga agagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctg gcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagtta gctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgg aattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcg cgggccgctctagaactagt