Difference between revisions of "IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22"

From OpenWetWare
Jump to: navigation, search
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
  
1. Projection of starters for sequencing something we want from pMPM-T5
+
1. Design of starters for sequencing something we want from pMPM-T5
  
 
Starters:
 
Starters:

Revision as of 01:23, 12 June 2008

Igem-logo-150px.png University of Warsaw iGEM Team 2008 <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

1. Design of starters for sequencing something we want from pMPM-T5

Starters:

pMPMT5seqF CTACTGTTTCTCCATACCCG

pMPMT5seqR GAAAATCTTCTCTCATCCGC

AIDseqP GCTTCGGCGCATCCTTTTG