Difference between revisions of "IGEM:PennState/Labbook/NoahJohnson"

From OpenWetWare
Jump to: navigation, search
 
(7 intermediate revisions by 2 users not shown)
Line 1: Line 1:
<h1>Noah Johnson</h1>
+
<h1>[[user:nrj5011|Noah Johnson]]</h1>
  
 
*Penn State iGEM 2007
 
*Penn State iGEM 2007
Line 27: Line 27:
 
name=IGEM:PennState/Labbook/NoahJohnson
 
name=IGEM:PennState/Labbook/NoahJohnson
 
date=2007/10/01
 
date=2007/10/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2008/01/01
 +
view=threemonths
 +
format=%name/%year-%month-%day
 +
weekstart=7
 +
</calendar>
 +
 +
<calendar>
 +
name=IGEM:PennState/Labbook/NoahJohnson
 +
date=2008/04/01
 
view=threemonths
 
view=threemonths
 
format=%name/%year-%month-%day
 
format=%name/%year-%month-%day
Line 151: Line 167:
 
</div>
 
</div>
  
<h2>[<span class="_togglegroup _toggle _toggler">June 6, 2007-Research</span><span class="_toggle _toggler" style="display:none;">June 6, 2007</span>]</h2>
+
<h2>[<span class="_togglegroup _toggle _toggler">June 11, 2007-Primer Sequencing</span><span class="_toggle _toggler" style="display:none;">June 11, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">XylA,B Primer</span><span class="_toggle _toggler" style="display:none;">XylA,B Primer</span>]
 
  <div class="_toggle" style="display:none;">
 
  <div class="_toggle" style="display:none;">
  
*Moved things into Richard Lab
+
3725940-3728788 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11074 Ecocyc]
*Researched diauxie project, read papers listed on ANGEL
 
*Updated Online Lab Notebook
 
  
</div>
+
<html><pre>
 +
TTACGCCATT AATGGCAGAA GTTGCTGATA GAGGCGACGG AACGTTTCTC GTCGTGGCTG
 +
ATAAGCGGCA TAACGCTGCG CATCTGGTAG ATGCGACTGT TCTAACGGTA GTTGCGGCAA
 +
CAATTCAATG AGCGATTTCT CTGGATTCGC CGCGATCTGC GCCAGCCTTG CTGCGCCCAG
 +
TGCTGGCCCC ACATCCCCCC CCGTACGGTA ATCGAGCTGC TGACCGCTGA TATCCGCCAG
 +
CATCTGACGC CAGTACTCAC TACGCGCCCC GCCCCCAATC AACGTAACAC TTTGCGGTTT
 +
AATACCGCAG GCATGCACGA CATCCATGCC ATCTGCCAGC GCATAACCCA CGCCTTCCAG
 +
CACTGCTCGC GCCAGTTCAT TGGGGCCATG TTGATGAGTC AAACCAAAGA AAACCCCCTT
 +
CGCCTGGGGA TTATTGTGTG GCGTACGCTC GCCGGAAAGA TAAGGCAGAA ACCAAACTGG
 +
CTCGGCACTT TCATCAGCCT GTTGAGCTGC AGCGATTAAA GCTGGGACAT TGCTCAGGCC
 +
GGTTAATTTC GCGGCCCAAT CCAGACACGA CGCTGCACTC AGCATCACAG ACATTAAATG
 +
CCAACGTTGC GGTAGCGCAT GGCAAAAGCT ATGTACGGCG CTTTCTGGCT TGCTTAAGAA
 +
CCCTTCGCTG ACAGCAAAAT AGACCCCCGA CGTCCCCAGC GATAACATTG CCTGATTAGC
 +
ATCAACCATT CCCACACCAA CTGCACCAGC TGCATTGTCG CCACCGCCTG CGACAACTGG
 +
CACCGTCGCC ATACCCCACG CTTTCGCAAC TTCAGGTAAC AAAGCACCAG TAATTTCGCT
 +
GCCTTCGTAT AATGCGGGCA TCTGGTCACG AGATAAGTCG CAAGCCTGCA GCATGACGTC
 +
ACTCCAGTCA CGCTTTGCGA CATCCAGCCA CATGGTGCCA GCTGCGTCAG ACATATCGCT
 +
GGCAAACTCC CCCGTCATAC GCAGACGCAA GTAATCTTTC GGTAATAATA CTTTGTCGAT
 +
TTGACGGAAT ATCTCCGGCT CATGCCGCTG AACCCATAGC AATTTAGGCG CAGTAAATCC
 +
GGGCATCATC AGGTTGCCGG TAATCACCCG CGATTGCGGA ACTCGCGCTT CCAGCAAAGT
 +
GCACTCTTGC GCACAGCGCC CGTCGTTCCA CAAAATGGCA GGGCGTAACA CCCGTTGCTG
 +
AGCATCCAGC AAGGTTGCTC CGTGCATCTG GCCGGCAATA CCCAATGCTT TAACGTCCTG
 +
CAGAGAATGC TGATCGCCCA GAGCTTTCAT TGCGCGATCA GTTGCCTGCC ACCACTGTTC
 +
CGGGTCTTGT TCCGACCAGA GTGGATGCGG GCGCGAAACG GTCAGCTTTT CCGTTTGCGC
 +
AGCAACCACC TCACCCTGCT CGTTGAGCAA AATAACTTTT ACGCCCGAGG TGCCAAGATC
 +
TATCCCGATA TACATATCGA TCGTTCCTTA AAAAAATGCC CGGTATCGCT ACCGATAACC
 +
GGGCCAACGG ACTGCACAGT TAGCCGTTAT TTGTCGAACA GATAATGGTT TACCAGATTT
 +
TCCAGTTGTT CCTGGCGACC ACTCTGATGC ACCGGAGACA AATGATGTTC CTGAGCATAT
 +
TTGGCTAAAT CTGCCAGTGA CATTTGGCCT TTCAGGATTT GCTGGCCCAA TTCGCTATTC
 +
CAGCCGGAAT AACGCTGCGC GATGCGTTTA TCCAGCTCGC CATCTTCAAT CATGCGCGCT
 +
GCAATTTTCA GCGCCAGTGC CATCGTATCC ATCGCGCCGA TATGACCGTA AAACAGATCA
 +
TATTTATCAG TACTTTGACG ACGTACTTTG GCATCGAAGT TCAGACCACC GGTGGTGAAA
 +
CCGCCTGCTT TGAGAATTTC ATACATCACC AGCGCATTCT CTTCCACACT GTTCGGGAAC
 +
TGGTCGGTGT CCCAGCCCAG TTGCGCATCG CCACGGTTGG CGTCGACAGA ACCGAACAGG
 +
CCAAGCGCAA TGGCGGTGGC TATTTCATGA TGGAAAGAGT GACCTGCCAG CGTCGCGTGG
 +
TTAGCTTCAA TGTTCAGTTT AATCTCTTTT TCCAGACCAA ACTGTTTCAG GAAGCCATAG
 +
ACCGTCGCGG CATCGTAATC ATATTGATGT TTGGTCGGTT CTTGCGGTTT CGGTTCGATA
 +
AGCAACGTGC CCTGGAAACC GATTTTATGT TTATGCTCAA CCACCATCTG CATAAAGCGG
 +
CCCAGTTGTT CACGCTCCTG ACGCAAGTCG GTATTTAACA GCGTTTCGTA ACCTTCACGA
 +
CCGCCCCACA GGACATAGTT TTCACCGCCC AATTTATGGG TTGCTTCCAT CGCTGTAACA
 +
ACTTGCGTTG CCGCCCAGCT GAAGACTTCA GGATCTGGGT TCGTCGCCGC ACCCGCGCCG
 +
TAGCGAGGGT TTGTAAAGCA GTTGGCCGTT CCCCACAGCA GCTTCACGCC GCTCTCTTCT
 +
TGCTTGCCTG CCAGGACATC AACCATTTGC GCAAAATTAT TGATGTACTC TTTTAACGAC
 +
GCGCCCTCAG GGGAAACATC CACATCGTGG AAGCAATAAA ATGGCACATG TAACTTGTGG
 +
AAAAACTCAA ATGCGACATC TGCTTTACGC TTCGCCAACG CCAGTGCCTC ACCAGGCTGC
 +
TGCCACGGAC GATTAAACGC CCCCACACCA AACATATCCG CCCCGTTCCA GCAGAAGGTG
 +
TGCCAGTAGC AGGCGGCAAA ACGCAAGTGC TCTTCCATAC GCTTACCCAA CACCAGTTCG
 +
TCGGGATTGT AGTGACGGAA TGCTAACGGG TTTGAGGATT TTGAGCCTTC ATAACGAACG
 +
CGATCGAGCT GGTCAAAATA GGCTTGCAT</pre></html>
  
 +
Left side primer:  gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA
  
  <head><script language="JavaScript">
+
Right side primer: ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA
  
// This script was written by Kurt A>
+
</div>
//http://www.geocities.com/soho/lofts/1238
 
// I only ask that you leave this plug to my page if you use the script.
 
// It worked for me, If it works for anyone else ----- I can't say.
 
// It times the user for a page and gives a response dependant on the
 
// duration of the visit to the page.
 
// It doesn't work well with the #links because anytime a back button
 
//is hit the script will envoke itself.
 
  
var STS = 0;
+
[<span class="_togglegroup _toggle _toggler">XylR Promoter Region Primer</span><span class="_toggle _toggler" style="display:none;">XylR Promoter Region Primer</span>]
var ETS = 0;
+
<div class="_toggle" style="display:none;">
var TIMON = 0;
 
  
function getStime() {
 
  
// optional audio welcome
+
3732905-3733001 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG20253 Ecocyc]
// location = "welcome.au";
 
  
now = new Date();
+
<html><pre>CAACCAAACG CCGTTCTTGA TTTTGATAAA AATTTTCTCA AAGCCGGTTA CGTATTACCG
 +
GTTTTGAGTT TTTGCATGAT TCAGCAGGAA AAGAACC</pre></html>
  
STS = (now.getTime());
+
Left side primer:  gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA
  
// optional.
+
Right side primer:  ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC
// changes the window status bar at bottom of page return true must remain
 
  
window.status = "I hope you enjoy"; return true ;
+
</div>
 
+
</div>
}
 
 
 
function figure() {
 
 
 
// code to get seconds from logon to logoff
 
 
 
postnow = new Date();
 
 
 
ETS = (postnow.getTime());
 
 
 
TIMEON = ((ETS - STS) / 1000);
 
 
 
// if less than 60 seconds
 
 
 
if (TIMEON < 60) {
 
 
 
// open an alert box and plead with user
 
 
 
alert ( TIMEON + " Seconds, Give it a chance");
 
 
 
// open a new window to play an audio plea.
 
 
 
win = window.open ("under.au","newwin");
 
 
 
}
 
 
 
else {
 
alert (TIMEON + "Thanks for reading");
 
win=window.open("http://www.computerhope.com","newwin");
 
 
 
}
 
 
 
return true;
 
}
 
</script>
 
 
 
<title></title>
 
 
 
</head>
 
 
 
<body onload="getStime()" ; onUnload="figure()" ; TEXT="#000040" LINK="#268999" VLINK="#FF0000" ALINK="#FFFF00">
 
 
 
</body>
 

Latest revision as of 11:50, 15 April 2008

Noah Johnson

Calender

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/04/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/07/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/10/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2008/01/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2008/04/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

[April 30, 2007-Bacterial Conjugation Presentation]

[May 24, 2007-Restriction Digest]

[May 30, 2007-Biofilms Presentation]

[June 4, 2007-iGEM Meeting Presentation]

[June 11, 2007-Primer Sequencing]