Difference between revisions of "IGEM:PennState/Labbook/NoahJohnson"

From OpenWetWare
Jump to: navigation, search
Line 147: Line 147:
 
   </tr>
 
   </tr>
 
</table>
 
</table>
 +
 +
</div>
 +
</div>
 +
 +
<h2>[<span class="_togglegroup _toggle _toggler">June 11, 2007-Primer Sequencing</span><span class="_toggle _toggler" style="display:none;">June 11, 2007</span>]</h2>
 +
<div class="_toggle" style="display:none;">
 +
[<span class="_togglegroup _toggle _toggler">XylA,B Primer</span><span class="_toggle _toggler" style="display:none;">XylA,B Primer</span>]
 +
<div class="_toggle" style="display:none;">
 +
 +
3725940-3728788 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG11074 Ecocyc]
 +
 +
<html><pre>
 +
TTACGCCATT AATGGCAGAA GTTGCTGATA GAGGCGACGG AACGTTTCTC GTCGTGGCTG
 +
ATAAGCGGCA TAACGCTGCG CATCTGGTAG ATGCGACTGT TCTAACGGTA GTTGCGGCAA
 +
CAATTCAATG AGCGATTTCT CTGGATTCGC CGCGATCTGC GCCAGCCTTG CTGCGCCCAG
 +
TGCTGGCCCC ACATCCCCCC CCGTACGGTA ATCGAGCTGC TGACCGCTGA TATCCGCCAG
 +
CATCTGACGC CAGTACTCAC TACGCGCCCC GCCCCCAATC AACGTAACAC TTTGCGGTTT
 +
AATACCGCAG GCATGCACGA CATCCATGCC ATCTGCCAGC GCATAACCCA CGCCTTCCAG
 +
CACTGCTCGC GCCAGTTCAT TGGGGCCATG TTGATGAGTC AAACCAAAGA AAACCCCCTT
 +
CGCCTGGGGA TTATTGTGTG GCGTACGCTC GCCGGAAAGA TAAGGCAGAA ACCAAACTGG
 +
CTCGGCACTT TCATCAGCCT GTTGAGCTGC AGCGATTAAA GCTGGGACAT TGCTCAGGCC
 +
GGTTAATTTC GCGGCCCAAT CCAGACACGA CGCTGCACTC AGCATCACAG ACATTAAATG
 +
CCAACGTTGC GGTAGCGCAT GGCAAAAGCT ATGTACGGCG CTTTCTGGCT TGCTTAAGAA
 +
CCCTTCGCTG ACAGCAAAAT AGACCCCCGA CGTCCCCAGC GATAACATTG CCTGATTAGC
 +
ATCAACCATT CCCACACCAA CTGCACCAGC TGCATTGTCG CCACCGCCTG CGACAACTGG
 +
CACCGTCGCC ATACCCCACG CTTTCGCAAC TTCAGGTAAC AAAGCACCAG TAATTTCGCT
 +
GCCTTCGTAT AATGCGGGCA TCTGGTCACG AGATAAGTCG CAAGCCTGCA GCATGACGTC
 +
ACTCCAGTCA CGCTTTGCGA CATCCAGCCA CATGGTGCCA GCTGCGTCAG ACATATCGCT
 +
GGCAAACTCC CCCGTCATAC GCAGACGCAA GTAATCTTTC GGTAATAATA CTTTGTCGAT
 +
TTGACGGAAT ATCTCCGGCT CATGCCGCTG AACCCATAGC AATTTAGGCG CAGTAAATCC
 +
GGGCATCATC AGGTTGCCGG TAATCACCCG CGATTGCGGA ACTCGCGCTT CCAGCAAAGT
 +
GCACTCTTGC GCACAGCGCC CGTCGTTCCA CAAAATGGCA GGGCGTAACA CCCGTTGCTG
 +
AGCATCCAGC AAGGTTGCTC CGTGCATCTG GCCGGCAATA CCCAATGCTT TAACGTCCTG
 +
CAGAGAATGC TGATCGCCCA GAGCTTTCAT TGCGCGATCA GTTGCCTGCC ACCACTGTTC
 +
CGGGTCTTGT TCCGACCAGA GTGGATGCGG GCGCGAAACG GTCAGCTTTT CCGTTTGCGC
 +
AGCAACCACC TCACCCTGCT CGTTGAGCAA AATAACTTTT ACGCCCGAGG TGCCAAGATC
 +
TATCCCGATA TACATATCGA TCGTTCCTTA AAAAAATGCC CGGTATCGCT ACCGATAACC
 +
GGGCCAACGG ACTGCACAGT TAGCCGTTAT TTGTCGAACA GATAATGGTT TACCAGATTT
 +
TCCAGTTGTT CCTGGCGACC ACTCTGATGC ACCGGAGACA AATGATGTTC CTGAGCATAT
 +
TTGGCTAAAT CTGCCAGTGA CATTTGGCCT TTCAGGATTT GCTGGCCCAA TTCGCTATTC
 +
CAGCCGGAAT AACGCTGCGC GATGCGTTTA TCCAGCTCGC CATCTTCAAT CATGCGCGCT
 +
GCAATTTTCA GCGCCAGTGC CATCGTATCC ATCGCGCCGA TATGACCGTA AAACAGATCA
 +
TATTTATCAG TACTTTGACG ACGTACTTTG GCATCGAAGT TCAGACCACC GGTGGTGAAA
 +
CCGCCTGCTT TGAGAATTTC ATACATCACC AGCGCATTCT CTTCCACACT GTTCGGGAAC
 +
TGGTCGGTGT CCCAGCCCAG TTGCGCATCG CCACGGTTGG CGTCGACAGA ACCGAACAGG
 +
CCAAGCGCAA TGGCGGTGGC TATTTCATGA TGGAAAGAGT GACCTGCCAG CGTCGCGTGG
 +
TTAGCTTCAA TGTTCAGTTT AATCTCTTTT TCCAGACCAA ACTGTTTCAG GAAGCCATAG
 +
ACCGTCGCGG CATCGTAATC ATATTGATGT TTGGTCGGTT CTTGCGGTTT CGGTTCGATA
 +
AGCAACGTGC CCTGGAAACC GATTTTATGT TTATGCTCAA CCACCATCTG CATAAAGCGG
 +
CCCAGTTGTT CACGCTCCTG ACGCAAGTCG GTATTTAACA GCGTTTCGTA ACCTTCACGA
 +
CCGCCCCACA GGACATAGTT TTCACCGCCC AATTTATGGG TTGCTTCCAT CGCTGTAACA
 +
ACTTGCGTTG CCGCCCAGCT GAAGACTTCA GGATCTGGGT TCGTCGCCGC ACCCGCGCCG
 +
TAGCGAGGGT TTGTAAAGCA GTTGGCCGTT CCCCACAGCA GCTTCACGCC GCTCTCTTCT
 +
TGCTTGCCTG CCAGGACATC AACCATTTGC GCAAAATTAT TGATGTACTC TTTTAACGAC
 +
GCGCCCTCAG GGGAAACATC CACATCGTGG AAGCAATAAA ATGGCACATG TAACTTGTGG
 +
AAAAACTCAA ATGCGACATC TGCTTTACGC TTCGCCAACG CCAGTGCCTC ACCAGGCTGC
 +
TGCCACGGAC GATTAAACGC CCCCACACCA AACATATCCG CCCCGTTCCA GCAGAAGGTG
 +
TGCCAGTAGC AGGCGGCAAA ACGCAAGTGC TCTTCCATAC GCTTACCCAA CACCAGTTCG
 +
TCGGGATTGT AGTGACGGAA TGCTAACGGG TTTGAGGATT TTGAGCCTTC ATAACGAACG
 +
CGATCGAGCT GGTCAAAATA GGCTTGCAT</pre></html>
 +
 +
Left side primer:  gaattcgcggccgcttctagag TTACGCCATT AATGGCAGAA
 +
 +
Right side primer:  ctgcagcggccgctactagta ATGCAAGCCT ATTTTGACCA
 +
 +
</div>
 +
 +
[<span class="_togglegroup _toggle _toggler">XylR Promoter Region Primer</span><span class="_toggle _toggler" style="display:none;">XylR Promoter Region Primer</span>]
 +
<div class="_toggle" style="display:none;">
 +
 +
 +
3732905-3733001 Found on [http://biocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG20253 Ecocyc]
 +
 +
<html><pre>CAACCAAACG CCGTTCTTGA TTTTGATAAA AATTTTCTCA AAGCCGGTTA CGTATTACCG
 +
GTTTTGAGTT TTTGCATGAT TCAGCAGGAA AAGAACC</pre></html>
 +
 +
Left side primer:  gaattcgcggccgcttctagag CAACCAAACG CCGTTCTTGA
 +
 +
Right side primer:  ctgcagcggccgctactagta GGTTCTTTTC CTGCTGAATC
  
 
  </div>
 
  </div>
 
</div>
 
</div>

Revision as of 13:01, 13 June 2007

Noah Johnson

Calender

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/04/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/07/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

<calendar> name=IGEM:PennState/Labbook/NoahJohnson date=2007/10/01 view=threemonths format=%name/%year-%month-%day weekstart=7 </calendar>

[April 30, 2007-Bacterial Conjugation Presentation]

[May 24, 2007-Restriction Digest]

[May 30, 2007-Biofilms Presentation]

[June 4, 2007-iGEM Meeting Presentation]

[June 11, 2007-Primer Sequencing]