IGEM:Peking University/2008/Experiment/PKU 0620 G2 1

From OpenWetWare
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Primer design

Primer 1
  • Primer name: F-HindIII-Apal-Gal4
  • Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA
  • Tm:64.9°C
Primer 2
  • Primer name: R-EcoRI-Spel-Gal4
  • Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT
  • Tm:61.3°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase 50*6ul
Volume (μL)
Template (pPT1) 0.5
dNTP 1
Enzyme 0.5
Buffer 10
F-HindIII-Apal-Gal4 0.5
R-EcoRI-Spel-Gal4 0.5
ddH2O 37
conditions
Temperature Time Length(0:00:00)
98°C 00:30
98°C 00:10 30 cycles
57.1,60.4,62.5,64.7,66.9,68.9°C 00:30 30 cycles
72°C 01:30 30 cycles
72°C 07:00
4°C Hold


Enzyme cutting-pPT1-XbaI-20 μL
Volumn(μL)
plasmid 5
XbaI 0.2
BSA 2
M Buffer 2
ddH2O 10.8
back to Previous Page