Difference between revisions of "IGEM:MIT/2008/Notebook/Yogurt/2008/06/16"

From OpenWetWare
Jump to: navigation, search
(Entry title)
Line 7: Line 7:
 
==Entry title==
 
==Entry title==
 
* sequence of prtB signal in L. Bulgaricus
 
* sequence of prtB signal in L. Bulgaricus
<-AAAGTTCCCGCCAGTGGACTCGCTGATAGGAGCAGTGCTGC
+
3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'
GGCTAATTCAGCCACTTTGTTCAAATGGCGTGCGGATTTTTTCTTCTGCAT <- start
+
** amino acid sequence
 +
M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T
  
  

Revision as of 11:44, 16 June 2008

Igem-logo-150px.png iGEM Project name 1 <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Entry title

  • sequence of prtB signal in L. Bulgaricus

3' TACGTCTTCTTTTTTAGGCGTGCGGTAAACTTGTTTCACCGACTTAATCGGCGTCGTGACGAGGATAGTCGCTCAGGTGACCGCCCTTGAAA 5'

    • amino acid sequence

M Q K K K S A R H L N K V A E L A A A L L L S A S P L A G T