IGEM:MIT/2006/Notebook/2006-8-9: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
(→To do) |
||
Line 26: | Line 26: | ||
#*remember ATF1 parts prob have 2 RBS | #*remember ATF1 parts prob have 2 RBS | ||
#SMELL LCs (and miniprep plus sequence promising ones) | #SMELL LCs (and miniprep plus sequence promising ones) | ||
#*remember that the ATF1 assembly is a mutant version | #*remember that the ATF1 assembly is a mutant version [J45014] | ||
#ATF1 mutagenesis (??) | #ATF1 mutagenesis (??) | ||
#make LCs of pUCP22 cell colonies (LB Amp) | #make LCs of pUCP22 cell colonies (LB Amp) |
Revision as of 10:45, 9 August 2006
Smells!!!! : )
- the banana and wintergreen generating devices are assembled and WORKING!!! YAY!!! what an exciting day :-D
Our New Biobricks!
Let's give a big warm welcome to:
- J45100 (Prom40+RBS30+BSMT+Term15)
- J45120 (Prom40+RBS32+BSMT+Term15)
- J45170 (PromOS+RBS32+BSMT+Term15)
- J45200 (Prom40+RBS30+ATF1+Term15)
- J45220 (Prom40+RBS32+ATF1+Term15)
We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:
- J45098 (BSMT+Term15)
- J45099 (RBS30+BSMT+Term15)
- J45119 (RBS32+BSMT+Term15)
- J45198 (RBS30+ATF1)
- J45199 (RBS30+ATF1+Term15)
- J45218 (RBS32+ATF1)
- J45219 (RBS32+ATF1+Term15)
J453xx, 4xx etc will be for the next devices we build.
To do
- check 42 sample sequencing order in VectorNTI
- remember ATF1 parts prob have 2 RBS
- SMELL LCs (and miniprep plus sequence promising ones)
- remember that the ATF1 assembly is a mutant version [J45014]
- ATF1 mutagenesis (??)
- make LCs of pUCP22 cell colonies (LB Amp)
- make LCs of overnight transformants (all in LB A/T, some with SA or IA)
BAT2 mutation primers to eliminate SpeI
Primer pair 3
* Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3' Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3' * GC content: 54.55% Location: 32-64 Melting temp: 80.6°C Mismatched bases: 1 Length: 33 bp Mutation: Substitution 5' flanking region: 16 bp Forward primer MW: 10187.73 Da 3' flanking region: 16 bp Reverse primer MW: 10080.66 Da