Difference between revisions of "IGEM:Harvard/2010/Team Allergy"

From OpenWetWare
Jump to: navigation, search
(Primers and Sequences)
(Primers and Sequences)
Line 180: Line 180:
 
|''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA
 
|''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA
 
|''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA
 
|''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA
]}
+
|}
  
 
==Protocols==
 
==Protocols==

Revision as of 06:36, 22 June 2010

Description

Strawberries iGEM 2010.png
Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Bibliography

Plant shRNA

  1. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 2001 Sep;27(6):581-90. PubMed ID:11576441 | HubMed [1]
  2. Schwab R, Ossowski S, Riester M, Warthmann N, and Weigel D. Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell. 2006 May;18(5):1121-33. DOI:10.1105/tpc.105.039834 | PubMed ID:16531494 | HubMed [2]
All Medline abstracts: PubMed | HubMed

Allergen silencing

  1. Dodo HW, Konan KN, Chen FC, Egnin M, and Viquez OM. Alleviating peanut allergy using genetic engineering: the silencing of the immunodominant allergen Ara h 2 leads to its significant reduction and a decrease in peanut allergenicity. Plant Biotechnol J. 2008 Feb;6(2):135-45. DOI:10.1111/j.1467-7652.2007.00292.x | PubMed ID:17784907 | HubMed [3]
  2. Singh MB and Bhalla PL. Genetic engineering for removing food allergens from plants. Trends Plant Sci. 2008 Jun;13(6):257-60. DOI:10.1016/j.tplants.2008.04.004 | PubMed ID:18467156 | HubMed [4]
  3. Le LQ, Mahler V, Lorenz Y, Scheurer S, Biemelt S, Vieths S, and Sonnewald U. Reduced allergenicity of tomato fruits harvested from Lyc e 1-silenced transgenic tomato plants. J Allergy Clin Immunol. 2006 Nov;118(5):1176-83. DOI:10.1016/j.jaci.2006.06.031 | PubMed ID:17088146 | HubMed [5]
  4. Gallo M and Sayre R. Removing allergens and reducing toxins from food crops. Curr Opin Biotechnol. 2009 Apr;20(2):191-6. DOI:10.1016/j.copbio.2009.03.005 | PubMed ID:19356919 | HubMed [6]
  5. Lorenz Y, Enrique E, Lequynh L, Fötisch K, Retzek M, Biemelt S, Sonnewald U, Vieths S, and Scheurer S. Skin prick tests reveal stable and heritable reduction of allergenic potency of gene-silenced tomato fruits. J Allergy Clin Immunol. 2006 Sep;118(3):711-8. DOI:10.1016/j.jaci.2006.05.014 | PubMed ID:16950292 | HubMed [7]
  6. Herman EM, Helm RM, Jung R, and Kinney AJ. Genetic modification removes an immunodominant allergen from soybean. Plant Physiol. 2003 May;132(1):36-43. DOI:10.1104/pp.103.021865 | PubMed ID:12746509 | HubMed [8]
  7. Gilissen LJ, Bolhaar ST, Matos CI, Rouwendal GJ, Boone MJ, Krens FA, Zuidmeer L, Van Leeuwen A, Akkerdaas J, Hoffmann-Sommergruber K, Knulst AC, Bosch D, Van de Weg WE, and Van Ree R. Silencing the major apple allergen Mal d 1 by using the RNA interference approach. J Allergy Clin Immunol. 2005 Feb;115(2):364-9. DOI:10.1016/j.jaci.2004.10.014 | PubMed ID:15696096 | HubMed [9]
  8. Bhalla PL and Singh MB. Knocking out expression of plant allergen genes. Methods. 2004 Mar;32(3):340-5. DOI:10.1016/j.ymeth.2003.08.011 | PubMed ID:14962769 | HubMed [10]
All Medline abstracts: PubMed | HubMed

Allergen proteins

  1. Chardin H, Mayer C, Sénéchal H, Wal JM, Poncet P, Desvaux FX, and Peltre G. Lipid transfer protein 1 is a possible allergen in Arabidopsis thaliana. Int Arch Allergy Immunol. 2003 Jun;131(2):85-90. DOI:10.1159/000070923 | PubMed ID:12811016 | HubMed [11]
  2. San Miguel-Moncín M, Krail M, Scheurer S, Enrique E, Alonso R, Conti A, Cisteró-Bahíma A, and Vieths S. Lettuce anaphylaxis: identification of a lipid transfer protein as the major allergen. Allergy. 2003 Jun;58(6):511-7. PubMed ID:12757453 | HubMed [12]
  3. Salcedo G, Sanchez-Monge R, Diaz-Perales A, Garcia-Casado G, and Barber D. Plant non-specific lipid transfer proteins as food and pollen allergens. Clin Exp Allergy. 2004 Sep;34(9):1336-41. DOI:10.1111/j.1365-2222.2004.02018.x | PubMed ID:15347364 | HubMed [13]
  4. Gajhede M, Osmark P, Poulsen FM, Ipsen H, Larsen JN, Joost van Neerven RJ, Schou C, Løwenstein H, and Spangfort MD. X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy. Nat Struct Biol. 1996 Dec;3(12):1040-5. PubMed ID:8946858 | HubMed [14]
  5. Zuidmeer L, Salentijn E, Rivas MF, Mancebo EG, Asero R, Matos CI, Pelgrom KT, Gilissen LJ, and van Ree R. The role of profilin and lipid transfer protein in strawberry allergy in the Mediterranean area. Clin Exp Allergy. 2006 May;36(5):666-75. DOI:10.1111/j.1365-2222.2006.02453.x | PubMed ID:16650053 | HubMed [15]
  6. Karlsson AL, Alm R, Ekstrand B, Fjelkner-Modig S, Schiött A, Bengtsson U, Björk L, Hjernø K, Roepstorff P, and Emanuelsson CS. Bet v 1 homologues in strawberry identified as IgE-binding proteins and presumptive allergens. Allergy. 2004 Dec;59(12):1277-84. DOI:10.1111/j.1398-9995.2004.00585.x | PubMed ID:15507096 | HubMed [16]
  7. Musidlowska-Persson A, Alm R, and Emanuelsson C. Cloning and sequencing of the Bet v 1-homologous allergen Fra a 1 in strawberry (Fragaria ananassa) shows the presence of an intron and little variability in amino acid sequence. Mol Immunol. 2007 Feb;44(6):1245-52. DOI:10.1016/j.molimm.2006.06.004 | PubMed ID:16945416 | HubMed [17]
  8. Breiteneder H and Ebner C. Molecular and biochemical classification of plant-derived food allergens. J Allergy Clin Immunol. 2000 Jul;106(1 Pt 1):27-36. DOI:10.1067/mai.2000.106929 | PubMed ID:10887301 | HubMed [18]
  9. Jensen-Jarolim E, Schmid B, Bernier F, Berna A, Kinaciyan T, Focke M, Ebner C, Scheiner O, and Boltz-Nitulescu G. Allergologic exploration of germins and germin-like proteins, a new class of plant allergens. Allergy. 2002 Sep;57(9):805-10. PubMed ID:12169176 | HubMed [19]
All Medline abstracts: PubMed | HubMed


Primers and Sequences

ihpRNA

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer
pdk intron AJ311872 CCTTGAATTCGCGGCCGCATCTAGA CCAATTGGTAAGGAAATAAT AAGGCTGCAGCGGCCGCTACTAGT TTCGAACCCAATTTCCCAAC
PME3 intron (746 bp) AF033204 CCTTGAATTCGCGGCCGCATCTAGA CTCCGCCACCGTTGGTAAGC AAGGCTGCAGCGGCCGCTACTAGT CGACGGACCCGCCGTGTTTT
PAL2 intron (240 bp) L33678.1 CCTTGAATTCGCGGCCGCATCTAGA ACAGAACTCATTAGGTAATT AAGGCTGCAGCGGCCGCTACTAGT TCCGGCGTTCAAAAATCTGA
GFP AF218816.1 CCTTGAATTCGCGGCCGCATCTAGA atggtgagcaagggcgagga AAGGCTGCAGCGGCCGCTACTAGT gaagatggtgcgctcctgga AAGGCTGCAGCGGCCGCTACTAGT atggtgagcaagggcgagga CCTTGAATTCGCGGCCGCATCTAGA gaagatggtgcgctcctgga
A. thaliana LTP1 ATHSEQB CCTTGAATTCGCGGCCGCATCTAGA ATGGCTGGAGTGATGAAGTT AAGGCTGCAGCGGCCGCTACTAGT CAGCTGCACGGCCAGCGTTG AAGGCTGCAGCGGCCGCTACTAGT ATGGCTGGAGTGATGAAGTT CCTTGAATTCGCGGCCGCATCTAGA CAGCTGCACGGCCAGCGTTG
Fra a 1A (Bet v 1) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTTTACACTTATGA AAGGCTGCAGCGGCCGCTACTAGT GTAGTCGATCTTCTCGATGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTTTACACTTATGA CCTTGAATTCGCGGCCGCATCTAGA GTAGTCGATCTTCTCGATGT
L. sativa LTP 1.1 EF101532.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGCAAGGATGGCAACGAT AAGGCTGCAGCGGCCGCTACTAGT TGACACCACACTTGCCGGGG AAGGCTGCAGCGGCCGCTACTAGT ATGGCAAGGATGGCAACGAT CCTTGAATTCGCGGCCGCATCTAGA TGACACCACACTTGCCGGGG
L. sativa LTP 1.2 EF101531.1 CCTTGAATTCGCGGCCGCATCTAGA GTGACATGTGGTCAGGTGGT AAGGCTGCAGCGGCCGCTACTAGT CTGGATCCTATTGCAGTCGG AAGGCTGCAGCGGCCGCTACTAGT GTGACATGTGGTCAGGTGGT CCTTGAATTCGCGGCCGCATCTAGA CTGGATCCTATTGCAGTCGG
S. lycopersicum Lyc E 1.01 (profilin) AJ417553 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAAACATATGT AAGGCTGCAGCGGCCGCTACTAGT AGCCTGATTGGTCTTCTTAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAAACATATGT CCTTGAATTCGCGGCCGCATCTAGA AGCCTGATTGGTCTTCTTAA
D. Carota Dau C 1 Z84376.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGCCCAGAGCCATTCAC AAGGCTGCAGCGGCCGCTACTAGT GGTTTCAATGGATTCGATGA AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGCCCAGAGCCATTCAC CCTTGAATTCGCGGCCGCATCTAGA GGTTTCAATGGATTCGATGA
Api g 4 (celery profilin) AF129423.1 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAGGCGTACGT AAGGCTGCAGCGGCCGCTACTAGT GGTTCATCATAGACTCCGAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAGGCGTACGT CCTTGAATTCGCGGCCGCATCTAGA GGTTCATCATAGACTCCGAA
Api g 1.0201 (celery) Z75662.2 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTCCAAAAGACCGT AAGGCTGCAGCGGCCGCTACTAGT CACCACTGACTCGAGTACGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTCCAAAAGACCGT CCTTGAATTCGCGGCCGCATCTAGA CACCACTGACTCGAGTACGT
Api g 1 (celery) Z48967.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGAGTGCAGACACATGT AAGGCTGCAGCGGCCGCTACTAGT GTTTTCAATGGATTCGATAA AAGGCTGCAGCGGCCGCTACTAGT ATGGGAGTGCAGACACATGT CCTTGAATTCGCGGCCGCATCTAGA GTTTTCAATGGATTCGATAA
A. Thaliana (BLAST) Bet v 1 (#1) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA ATGATAGAAGAGGAGATTGA AAGGCTGCAGCGGCCGCTACTAGT TACCATATTAAAAAATACGT AAGGCTGCAGCGGCCGCTACTAGT ATGATAGAAGAGGAGATTGA CCTTGAATTCGCGGCCGCATCTAGA TACCATATTAAAAAATACGT
A. Thaliana (BLAST) Bet v 1 (#2) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA AAATTCATTTATAAACGCAT AAGGCTGCAGCGGCCGCTACTAGT TTAATCCTTAGACAAGAGGT AAGGCTGCAGCGGCCGCTACTAGT AAATTCATTTATAAACGCAT CCTTGAATTCGCGGCCGCATCTAGA TTAATCCTTAGACAAGAGGT
A. thaliana GER3 NM_122070 CCTTGAATTCGCGGCCGCATCTAGA ATGAAGATGATAATCCAAAT AAGGCTGCAGCGGCCGCTACTAGT GATGACACCACCACCGGCTA AAGGCTGCAGCGGCCGCTACTAGT ATGAAGATGATAATCCAAAT CCTTGAATTCGCGGCCGCATCTAGA GATGACACCACCACCGGCTA
Fra a 1 Exon2 (for hair pin) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA GCAGCCACTACGGGTACGTC AAGGCTGCAGCGGCCGCTACTAGT TTAGTTGTATTCGCTGGGGT AAGGCTGCAGCGGCCGCTACTAGT GCAGCCACTACGGGTACGTC CCTTGAATTCGCGGCCGCATCTAGA TTAGTTGTATTCGCTGGGGT
Fra a 1 intron DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATCACCTTTGGTGAAGGTAT AAGGCTGCAGCGGCCGCTACTAGT ACCCGTAGTGGCTGCCTGTC AAGGCTGCAGCGGCCGCTACTAGT ATCACCTTTGGTGAAGGTAT CCTTGAATTCGCGGCCGCATCTAGA ACCCGTAGTGGCTGCCTGTC

amiRNA

forward reverse
CCTTGAATTCGCGGCCGCATCTAGA CCCACAAACACACGCTCGGA AAGGCTGCAGCGGCCGCTACTAGT CCCCATGGCGATGCCTTAAA

Protocols

Isolating Genes From Plants

Strawberry Transformation

  1. Schaart JG, Krens FA, Pelgrom KT, Mendes O, and Rouwendal GJ. Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol J. 2004 May;2(3):233-40. DOI:10.1111/j.1467-7652.2004.00067.x | PubMed ID:17147614 | HubMed [1]
  2. Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, and Shulaev V. High-efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics. Planta. 2006 May;223(6):1219-30. DOI:10.1007/s00425-005-0170-3 | PubMed ID:16320068 | HubMed [2]
  3. Husaini AM. Pre- and post-agroinfection strategies for efficient leaf disk transformation and regeneration of transgenic strawberry plants. Plant Cell Rep. 2010 Jan;29(1):97-110. DOI:10.1007/s00299-009-0801-4 | PubMed ID:19956955 | HubMed [3]
  4. Graham J, McNicol RJ, and Kumar A. Agrobacterium-mediated transformation of soft fruit Rubus, Ribes, and Fragaria. Methods Mol Biol. 1995;44:129-33. DOI:10.1385/0-89603-302-3:129 | PubMed ID:7581659 | HubMed [4]
All Medline abstracts: PubMed | HubMed

amiRNA

Plasmids

Introns

ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns: