Difference between revisions of "IGEM:Harvard/2010/Team Allergy"

From OpenWetWare
Jump to: navigation, search
(Protocols)
(Introns)
Line 190: Line 190:
  
 
==Introns==
 
==Introns==
ihpRNA production requires the selection of an intron. Here's one (between || in the range 295..396): [http://www.ncbi.nlm.nih.gov/nuccore/D64156.1 D64156.1]
+
ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns:
<pre>
+
*[http://www.ncbi.nlm.nih.gov/nuccore/2895509 PME3, 746bp]
        1 tgtagtaatg tgtatatata ggtggtcgtg ttacgcgagg aggaacacag caaactcatc
+
*[http://www.ncbi.nlm.nih.gov/nuccore/497420 PAL2, 240bp]
      61 aaatctgggg ttgacaagaa tctggtactg tctacaagca atagttatta ctccccaaag
 
      121 gtgtggttgg tgggggatgg aatagagaac gaagagcaga tgaaagcaaa agaaggaacc
 
      181 ctctttgttc ccttttctca ctttccgccc aacaaactcc gcaaggactg tttctaccag
 
      241 tccactccag ctatgcgtgt tcccaagtct gcccaaaaca tcgactcctg tgag|gtacat
 
      301 ctttgaattc ttatagatat atctgtaact tttatattat ataagctgat agatgtgttc
 
      361 atctataatg aatgaatggt tgttatatat atatag|aact ggctggggag gagggtgatg
 
      421 agtgcatgga aaataggagg tatagtgcat gcacttgagg gttgggagga gcatgactgc
 
      481 ggcaacactt gcaacgtcct ccgtctccac gccatatggg aagctgctct tcgccatgat
 
      541 ttccaacctc tcccaccatc tcctctatga gcttttttca tattcataca tctatgtccc
 
      601 ct
 
</pre>
 
*[http://www.ncbi.nlm.nih.gov/nuccore/L33679.1 PAL 3] intron 2303-2992
 
<pre>
 
  1 ttttatctat ctttttattt tcttgtgtgg attgcttgtg attttgtttg ttggcctaat
 
      61 aatcagcttg gattttttag ctttcttgga aataaaagaa gatcacgata attaattact
 
      121 ttatggtccc aacctacaaa ttgttggact actattggaa ctaacaaata aatacacgaa
 
      181 attgattggg tgagttataa tattaccttt ttagtttttg atatagtcaa attttatagt
 
      241 ataacagatt tgttaaaatt aaattgtatc gaaacttctt atagtaatgt actaatgtga
 
      301 gaaaatctgt gtactgttat tatagtatac gcgttttaat acttttatta ttattcctac
 
      361 ttaaagaaaa taccaaatat ttttccgttt tttgggtgtg tttagttctt ttttttttaa
 
      421 ctgaaggatt ttggtgaatt ttctgttgcc attaaaaata tttgtgttta gttttttgat
 
      481 attttaattc tttacttttt tttaagataa tcaatgwwgg accaacatcc caaatgtgaa
 
      541 ccaaactccg acccgaaanc cgctgctttc aatactttca atcgaaatag cgtgtgacgt
 
      601 gtgttaatat ctgcatgcat tgattatcgg acaatgacaa atattctatt tatcctaaat
 
      661 tttattctcc gtgaagtaca catttggaca aaccaaacgt agatttgaga aaaaaatgcg
 
      721 gaaaacccaa agtctatccg tggcgaagaa taagaggcaa aaacggggaa tataacccaa
 
      781 agtctaaacc caataattat tttattgata atcaaaatct atcacgagaa agacgacgtt
 
      841 ttgacatctc agtcgttata aatttcaata aattatgttt cccttgaact gattcacatg
 
      901 tcattttcat tccacatata tacgccaatc gtgtaatctt ttagattatc gatcgaacat
 
      961 ctaaattttg tcaacatgtt aatgaatatc taaggaacgc tatcgsstat cgcttttttc
 
    1021 aacataagtc taatttgaga gatgttaatc caccgcatgt tgagtggtgt aagagagaaa
 
    1081 gagccgccac taggctactt gtctcccaac aacaatatat atcctgaatt atgaattatg
 
    1141 caattatact tttctggtca ttcaattatt attacttttg ttttgttcaa aatgctttag
 
    1201 tgtactactt tcaaatttca acatccttct ttatttattt caactttttt ctcaacatta
 
    1261 tcgtttcttt tttsctgtcg ataacaacaa cttgttgagt gtcttgcaaa gattagcctt
 
    1321 ttactcgatt ccccgtttga ttagatttta aggctttccg ttaaccttta acagttaaca
 
    1381 aagtgtggag tgcctagcaa agacaattgt gctttgtkky ggcggcaacg tcagcaacgr
 
    1441 ttttaggact tctacttctg atgagagata cagakcgttg ccwygttgaa aaagaaatta
 
    1501 aaaggaaaac ataacacatt atacgagaaa gaagtttaaa aaaaaaaaaa actggttgaa
 
    1561 actaatcgaa tatttgaagc attttttata tctactagaa agtaagtttt ttaatggcta
 
    1621 aaaacgaata atcctattca ttattttaar tcaaacacta ataagatgtt cttaaacatt
 
    1681 tcaactagtt aaccccattg ttttccctct atatatatac cccaccaagg cacaaaccaa
 
    1741 cccactcact cacattattt aaaacacatg ttttactact tgtctacata tatctatata
 
    1801 atcatcgtag aaatcgatac ttgaggccag cccaaaatca cactcgagtc gaatatatat
 
    1861 atatatatat atatcttaat ccggctcgtt atataaaagc tccagacttg tcactagggt
 
    1921 tgccgtcaga ttttgtgatc atggagtttc gtcaaccaaa cgcaacagca ttgagcgacc
 
    1981 cacttaactg gaatgtagcg gcggaggctt taaaagggag ccacctggag gaggtgaaga
 
    2041 agatggtgaa ggattatagg aaaggaacgg tgcagctagg cggagagacg ctgaccatcg
 
    2101 gtcaggttgc ggcagtagcg agtggaggag gaccgacagt ggagctttct gaggaggctc
 
    2161 ggggcggtgt gaaggcgagt agtgactggg tgatggagag catgaaccgt gatacggaca
 
    2221 catatgggat caccactgga tttggttcat cttctcgtag gaggactgac caaggtgctg
 
    2281 ctcttcaaaa agagcttatt aggtaatt|ca tattcatagt tgaatcagac gaaaaataaa
 
    2341 tagaatcata gaaaactagg tttagaaacc cgtacataaa ctagtttttt taaaaaggaa
 
    2401 tssatattta tatccagcgc ctatagataa agaacaagac attttataat ctgtctcgac
 
    2461 gtttttacac caacaaatga gaataattag tcgtactata aaagttcaaa tttctttaaa
 
    2521 tatgattaaa cgaagactaa aacgctctaa gttttactac atttttaaat aaatacgact
 
    2581 ttttgccgaa agaaaacata gtacttaaga taagagcatt ttgtgttcta atgaaaatta
 
    2641 aacgtttctg cattctctat tcttttgact gtcttatact tttattgaaa taagcttttt
 
    2701 ttaacttttg taaatcagct ttaacgaaaa aagaatgtag tgactagtgg agcacggagg
 
    2761 caaagttgct agctttgtac accttttttt tatttttgtc ttttgggttg taacttagat
 
    2821 aagaagaggt ctcagtccgt aaaaagttta aacggtatcg attaaaattg tttaagctaa
 
    2881 aagaggtagt agtcgaagtt attaaatgca ttatattata tagttgacaa aagtaattaa
 
    2941 aaaataaatg taatcggttt aaaactgacg gatcccaaat tatatcaacc ag|gtatttga
 
    3001 acgccgggat attcgctacc ggcaacgaag atgacgacag gtcaaacacg cttccccggc
 
    3061 cggctactag agcagcgatg ctcatccgtg taaacaccct cctccaaggc tactctggta
 
    3121 tacgctttga gatcctcgaa gccatcacaa cactcctcaa ctgcaaaatt acaccgctcc
 
    3181 ttcctctccg aggcaccatt accgcctccg gggatctcgt tccgttatcc tatatcgctg
 
    3241 gattcctcat cgggcgcccc aactcccgat ccgtgggccc ctctggcgag atcctcactg
 
    3301 ccttggaggc cttcaagctc gctggagtat cgtctttttt cgaactcagg cctaaagaag
 
    3361 ggcttgcgct cgtgaatggg actgcggtgg ggtctgcttt agcctctacg gtactgtacg
 
    3421 atgccaacat tttggtggtt ttctccgaag ttgcttccgc catgtttgca gaggttatgc
 
    3481 aggggaaacc agagtttacc gatcatctta cgcataaact caagcaccat cctggtcaga
 
    3541 tcgaagccgc cgctatcatg gagcatattc tagacggaag ctcttatgta aaagaagctc
 
    3601 tacatctcca caagattgat ccgcttcaga aacctaaaca agatcggtat gttcttgggt
 
    3661 atcaagcaac tagtttcttg taactcaagt aacccttttg atttgctttc tgattaaatt
 
    3721 gacttatagt ttcgtgttta aattaacagt tacgctctgc gaacatctcc gcaatggctt
 
    3781 ggaccgcaga ttgaggtgat aagagcagcg actaagatga tcgaacgtga gataaactca
 
    3841 gtaaacgata accctttgat cgatgtttca agaaacaaag ctatccatgg tgggaacttc
 
    3901 caggggacac caattggtgt cgccatggat aacactcgtc tagcacttgc ttctatcggg
 
    3961 aagctaatgt tcgctcagtt cactgaactc gtaaatgatt tctacaacaa cgggttaccc
 
    4021 tctaatctat ctggtggtag aaaccctagt cttgattacg ggttaaaagg cgcagaagtc
 
    4081 gccatggctt cttattgctc agagcttcag ttcctagcaa atcctgtgac gaaccatgtc
 
    4141 gaaagcgctt ctcaacacaa tcaagatgtt aactctcttg ggctgatctc gagccgaacg
 
    4201 acagcagaag ctgtggttat cctcaagctc atgtcaacga cttacttggt agctttgtgc
 
    4261 caagcctttg atctgagaca ccttgaagaa attctcaaga aagcggttaa tgaggttgtg
 
    4321 agccacactg ccaaaagcgt tctagcaatc gaaccattcc gcaaacacga cgatattctt
 
    4381 ggagttgtca accgcgaata cgtcttctcc tatgttgatg acccaagcag cctcactaac
 
    4441 cctttaatgc agaagctgag acatgtcctc ttcgacaaag ctttagctga accggaaggc
 
    4501 gagaccgaca cggtttttcg gaaaatcgga gcgttcgagg ccgagctgaa atttctcctc
 
    4561 cctaaagaag tggaacgagt caggacagag tacgagaacg gtacatttaa tgtggctaac
 
    4621 cgaatcaaga agtgtcgatc gtatccgctg taccggtttg tgcggaatga actcgagacg
 
    4681 aggttgctaa ccggagagga tgttcggtca ccgggagagg attttgacaa agtcttcagg
 
    4741 gctatatctc aaggaaaact catagawcct ctgtttgaat gtctgaaaga gtggaacggt
 
    4801 gctccgattt ctatctgcta aaacgtttcg tcagatctcc atatatcgag aataataaac
 
    4861 acaccattcg aaaatatttg gttgtgtagt aatcgtcttg ccttcgcctt ttcaataatg
 
    4921 tcctg
 
</pre>
 

Revision as of 06:24, 22 June 2010

Description

Strawberries iGEM 2010.png
Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Bibliography

Plant shRNA

  1. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 2001 Sep;27(6):581-90. PubMed ID:11576441 | HubMed [1]
  2. Schwab R, Ossowski S, Riester M, Warthmann N, and Weigel D. Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell. 2006 May;18(5):1121-33. DOI:10.1105/tpc.105.039834 | PubMed ID:16531494 | HubMed [2]
All Medline abstracts: PubMed | HubMed

Allergen silencing

  1. Dodo HW, Konan KN, Chen FC, Egnin M, and Viquez OM. Alleviating peanut allergy using genetic engineering: the silencing of the immunodominant allergen Ara h 2 leads to its significant reduction and a decrease in peanut allergenicity. Plant Biotechnol J. 2008 Feb;6(2):135-45. DOI:10.1111/j.1467-7652.2007.00292.x | PubMed ID:17784907 | HubMed [3]
  2. Singh MB and Bhalla PL. Genetic engineering for removing food allergens from plants. Trends Plant Sci. 2008 Jun;13(6):257-60. DOI:10.1016/j.tplants.2008.04.004 | PubMed ID:18467156 | HubMed [4]
  3. Le LQ, Mahler V, Lorenz Y, Scheurer S, Biemelt S, Vieths S, and Sonnewald U. Reduced allergenicity of tomato fruits harvested from Lyc e 1-silenced transgenic tomato plants. J Allergy Clin Immunol. 2006 Nov;118(5):1176-83. DOI:10.1016/j.jaci.2006.06.031 | PubMed ID:17088146 | HubMed [5]
  4. Gallo M and Sayre R. Removing allergens and reducing toxins from food crops. Curr Opin Biotechnol. 2009 Apr;20(2):191-6. DOI:10.1016/j.copbio.2009.03.005 | PubMed ID:19356919 | HubMed [6]
  5. Lorenz Y, Enrique E, Lequynh L, Fötisch K, Retzek M, Biemelt S, Sonnewald U, Vieths S, and Scheurer S. Skin prick tests reveal stable and heritable reduction of allergenic potency of gene-silenced tomato fruits. J Allergy Clin Immunol. 2006 Sep;118(3):711-8. DOI:10.1016/j.jaci.2006.05.014 | PubMed ID:16950292 | HubMed [7]
  6. Herman EM, Helm RM, Jung R, and Kinney AJ. Genetic modification removes an immunodominant allergen from soybean. Plant Physiol. 2003 May;132(1):36-43. DOI:10.1104/pp.103.021865 | PubMed ID:12746509 | HubMed [8]
  7. Gilissen LJ, Bolhaar ST, Matos CI, Rouwendal GJ, Boone MJ, Krens FA, Zuidmeer L, Van Leeuwen A, Akkerdaas J, Hoffmann-Sommergruber K, Knulst AC, Bosch D, Van de Weg WE, and Van Ree R. Silencing the major apple allergen Mal d 1 by using the RNA interference approach. J Allergy Clin Immunol. 2005 Feb;115(2):364-9. DOI:10.1016/j.jaci.2004.10.014 | PubMed ID:15696096 | HubMed [9]
  8. Bhalla PL and Singh MB. Knocking out expression of plant allergen genes. Methods. 2004 Mar;32(3):340-5. DOI:10.1016/j.ymeth.2003.08.011 | PubMed ID:14962769 | HubMed [10]
All Medline abstracts: PubMed | HubMed

Allergen proteins

  1. Chardin H, Mayer C, Sénéchal H, Wal JM, Poncet P, Desvaux FX, and Peltre G. Lipid transfer protein 1 is a possible allergen in Arabidopsis thaliana. Int Arch Allergy Immunol. 2003 Jun;131(2):85-90. DOI:10.1159/000070923 | PubMed ID:12811016 | HubMed [11]
  2. San Miguel-Moncín M, Krail M, Scheurer S, Enrique E, Alonso R, Conti A, Cisteró-Bahíma A, and Vieths S. Lettuce anaphylaxis: identification of a lipid transfer protein as the major allergen. Allergy. 2003 Jun;58(6):511-7. PubMed ID:12757453 | HubMed [12]
  3. Salcedo G, Sanchez-Monge R, Diaz-Perales A, Garcia-Casado G, and Barber D. Plant non-specific lipid transfer proteins as food and pollen allergens. Clin Exp Allergy. 2004 Sep;34(9):1336-41. DOI:10.1111/j.1365-2222.2004.02018.x | PubMed ID:15347364 | HubMed [13]
  4. Gajhede M, Osmark P, Poulsen FM, Ipsen H, Larsen JN, Joost van Neerven RJ, Schou C, Løwenstein H, and Spangfort MD. X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy. Nat Struct Biol. 1996 Dec;3(12):1040-5. PubMed ID:8946858 | HubMed [14]
  5. Zuidmeer L, Salentijn E, Rivas MF, Mancebo EG, Asero R, Matos CI, Pelgrom KT, Gilissen LJ, and van Ree R. The role of profilin and lipid transfer protein in strawberry allergy in the Mediterranean area. Clin Exp Allergy. 2006 May;36(5):666-75. DOI:10.1111/j.1365-2222.2006.02453.x | PubMed ID:16650053 | HubMed [15]
  6. Karlsson AL, Alm R, Ekstrand B, Fjelkner-Modig S, Schiött A, Bengtsson U, Björk L, Hjernø K, Roepstorff P, and Emanuelsson CS. Bet v 1 homologues in strawberry identified as IgE-binding proteins and presumptive allergens. Allergy. 2004 Dec;59(12):1277-84. DOI:10.1111/j.1398-9995.2004.00585.x | PubMed ID:15507096 | HubMed [16]
  7. Musidlowska-Persson A, Alm R, and Emanuelsson C. Cloning and sequencing of the Bet v 1-homologous allergen Fra a 1 in strawberry (Fragaria ananassa) shows the presence of an intron and little variability in amino acid sequence. Mol Immunol. 2007 Feb;44(6):1245-52. DOI:10.1016/j.molimm.2006.06.004 | PubMed ID:16945416 | HubMed [17]
  8. Breiteneder H and Ebner C. Molecular and biochemical classification of plant-derived food allergens. J Allergy Clin Immunol. 2000 Jul;106(1 Pt 1):27-36. DOI:10.1067/mai.2000.106929 | PubMed ID:10887301 | HubMed [18]
  9. Jensen-Jarolim E, Schmid B, Bernier F, Berna A, Kinaciyan T, Focke M, Ebner C, Scheiner O, and Boltz-Nitulescu G. Allergologic exploration of germins and germin-like proteins, a new class of plant allergens. Allergy. 2002 Sep;57(9):805-10. PubMed ID:12169176 | HubMed [19]
All Medline abstracts: PubMed | HubMed


Primers and Sequences

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer
pdk intron AJ311872 CCTTGAATTCGCGGCCGCATCTAGA CCAATTGGTAAGGAAATAAT AAGGCTGCAGCGGCCGCTACTAGT TTCGAACCCAATTTCCCAAC
PME3 intron (746 bp) AF033204 CCTTGAATTCGCGGCCGCATCTAGA CTCCGCCACCGTTGGTAAGC AAGGCTGCAGCGGCCGCTACTAGT CGACGGACCCGCCGTGTTTT
PAL2 intron (240 bp) L33678.1 CCTTGAATTCGCGGCCGCATCTAGA ACAGAACTCATTAGGTAATT AAGGCTGCAGCGGCCGCTACTAGT TCCGGCGTTCAAAAATCTGA
GFP AF218816.1 CCTTGAATTCGCGGCCGCATCTAGA atggtgagcaagggcgagga AAGGCTGCAGCGGCCGCTACTAGT gaagatggtgcgctcctgga AAGGCTGCAGCGGCCGCTACTAGT atggtgagcaagggcgagga CCTTGAATTCGCGGCCGCATCTAGA gaagatggtgcgctcctgga
A. thaliana LTP1 ATHSEQB CCTTGAATTCGCGGCCGCATCTAGA ATGGCTGGAGTGATGAAGTT AAGGCTGCAGCGGCCGCTACTAGT CAGCTGCACGGCCAGCGTTG AAGGCTGCAGCGGCCGCTACTAGT ATGGCTGGAGTGATGAAGTT CCTTGAATTCGCGGCCGCATCTAGA CAGCTGCACGGCCAGCGTTG
Fra a 1A (Bet v 1) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTTTACACTTATGA AAGGCTGCAGCGGCCGCTACTAGT GTAGTCGATCTTCTCGATGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTTTACACTTATGA CCTTGAATTCGCGGCCGCATCTAGA GTAGTCGATCTTCTCGATGT
L. sativa LTP 1.1 EF101532.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGCAAGGATGGCAACGAT AAGGCTGCAGCGGCCGCTACTAGT TGACACCACACTTGCCGGGG AAGGCTGCAGCGGCCGCTACTAGT ATGGCAAGGATGGCAACGAT CCTTGAATTCGCGGCCGCATCTAGA TGACACCACACTTGCCGGGG
L. sativa LTP 1.2 EF101531.1 CCTTGAATTCGCGGCCGCATCTAGA GTGACATGTGGTCAGGTGGT AAGGCTGCAGCGGCCGCTACTAGT CTGGATCCTATTGCAGTCGG AAGGCTGCAGCGGCCGCTACTAGT GTGACATGTGGTCAGGTGGT CCTTGAATTCGCGGCCGCATCTAGA CTGGATCCTATTGCAGTCGG
S. lycopersicum Lyc E 1.01 (profilin) AJ417553 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAAACATATGT AAGGCTGCAGCGGCCGCTACTAGT AGCCTGATTGGTCTTCTTAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAAACATATGT CCTTGAATTCGCGGCCGCATCTAGA AGCCTGATTGGTCTTCTTAA
D. Carota Dau C 1 Z84376.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGCCCAGAGCCATTCAC AAGGCTGCAGCGGCCGCTACTAGT GGTTTCAATGGATTCGATGA AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGCCCAGAGCCATTCAC CCTTGAATTCGCGGCCGCATCTAGA GGTTTCAATGGATTCGATGA
Api g 4 (celery profilin) AF129423.1 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAGGCGTACGT AAGGCTGCAGCGGCCGCTACTAGT GGTTCATCATAGACTCCGAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAGGCGTACGT CCTTGAATTCGCGGCCGCATCTAGA GGTTCATCATAGACTCCGAA
Api g 1.0201 (celery) Z75662.2 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTCCAAAAGACCGT AAGGCTGCAGCGGCCGCTACTAGT CACCACTGACTCGAGTACGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTCCAAAAGACCGT CCTTGAATTCGCGGCCGCATCTAGA CACCACTGACTCGAGTACGT
Api g 1 (celery) Z48967.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGAGTGCAGACACATGT AAGGCTGCAGCGGCCGCTACTAGT GTTTTCAATGGATTCGATAA AAGGCTGCAGCGGCCGCTACTAGT ATGGGAGTGCAGACACATGT CCTTGAATTCGCGGCCGCATCTAGA GTTTTCAATGGATTCGATAA
A. Thaliana (BLAST) Bet v 1 (#1) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA ATGATAGAAGAGGAGATTGA AAGGCTGCAGCGGCCGCTACTAGT TACCATATTAAAAAATACGT AAGGCTGCAGCGGCCGCTACTAGT ATGATAGAAGAGGAGATTGA CCTTGAATTCGCGGCCGCATCTAGA TACCATATTAAAAAATACGT
A. Thaliana (BLAST) Bet v 1 (#2) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA AAATTCATTTATAAACGCAT AAGGCTGCAGCGGCCGCTACTAGT TTAATCCTTAGACAAGAGGT AAGGCTGCAGCGGCCGCTACTAGT AAATTCATTTATAAACGCAT CCTTGAATTCGCGGCCGCATCTAGA TTAATCCTTAGACAAGAGGT
A. thaliana GER3 NM_122070 CCTTGAATTCGCGGCCGCATCTAGA ATGAAGATGATAATCCAAAT AAGGCTGCAGCGGCCGCTACTAGT GATGACACCACCACCGGCTA AAGGCTGCAGCGGCCGCTACTAGT ATGAAGATGATAATCCAAAT CCTTGAATTCGCGGCCGCATCTAGA GATGACACCACCACCGGCTA
Fra a 1 Exon2 (for hair pin) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA GCAGCCACTACGGGTACGTC AAGGCTGCAGCGGCCGCTACTAGT TTAGTTGTATTCGCTGGGGT AAGGCTGCAGCGGCCGCTACTAGT GCAGCCACTACGGGTACGTC CCTTGAATTCGCGGCCGCATCTAGA TTAGTTGTATTCGCTGGGGT
Fra a 1 intron DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATCACCTTTGGTGAAGGTAT AAGGCTGCAGCGGCCGCTACTAGT ACCCGTAGTGGCTGCCTGTC AAGGCTGCAGCGGCCGCTACTAGT ATCACCTTTGGTGAAGGTAT CCTTGAATTCGCGGCCGCATCTAGA ACCCGTAGTGGCTGCCTGTC

Protocols

Isolating Genes From Plants

Strawberry Transformation

  1. Schaart JG, Krens FA, Pelgrom KT, Mendes O, and Rouwendal GJ. Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol J. 2004 May;2(3):233-40. DOI:10.1111/j.1467-7652.2004.00067.x | PubMed ID:17147614 | HubMed [1]
  2. Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, and Shulaev V. High-efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics. Planta. 2006 May;223(6):1219-30. DOI:10.1007/s00425-005-0170-3 | PubMed ID:16320068 | HubMed [2]
  3. Husaini AM. Pre- and post-agroinfection strategies for efficient leaf disk transformation and regeneration of transgenic strawberry plants. Plant Cell Rep. 2010 Jan;29(1):97-110. DOI:10.1007/s00299-009-0801-4 | PubMed ID:19956955 | HubMed [3]
  4. Graham J, McNicol RJ, and Kumar A. Agrobacterium-mediated transformation of soft fruit Rubus, Ribes, and Fragaria. Methods Mol Biol. 1995;44:129-33. DOI:10.1385/0-89603-302-3:129 | PubMed ID:7581659 | HubMed [4]
All Medline abstracts: PubMed | HubMed

amiRNA

Plasmids

Introns

ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns: