Difference between revisions of "IGEM:Harvard/2010/Team Allergy"

From OpenWetWare
Jump to: navigation, search
(Primers and Sequences)
Line 142: Line 142:
|Fra a 1 Exon (for hair pin)
|Fra a 1 Exon2 (for hair pin)
|''CCTTGAATTCGCGGCCGCATCTAGA'' acgtcaagcacaagatccac
|''CCTTGAATTCGCGGCCGCATCTAGA'' acgtcaagcacaagatccac

Revision as of 08:56, 21 June 2010


Strawberries iGEM 2010.png
Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Plant shRNA

  1. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 2001 Sep;27(6):581-90. PubMed ID:11576441 | HubMed [1]
  2. Schwab R, Ossowski S, Riester M, Warthmann N, and Weigel D. Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell. 2006 May;18(5):1121-33. DOI:10.1105/tpc.105.039834 | PubMed ID:16531494 | HubMed [2]
All Medline abstracts: PubMed | HubMed

Allergen silencing

  1. Dodo HW, Konan KN, Chen FC, Egnin M, and Viquez OM. Alleviating peanut allergy using genetic engineering: the silencing of the immunodominant allergen Ara h 2 leads to its significant reduction and a decrease in peanut allergenicity. Plant Biotechnol J. 2008 Feb;6(2):135-45. DOI:10.1111/j.1467-7652.2007.00292.x | PubMed ID:17784907 | HubMed [3]
  2. Singh MB and Bhalla PL. Genetic engineering for removing food allergens from plants. Trends Plant Sci. 2008 Jun;13(6):257-60. DOI:10.1016/j.tplants.2008.04.004 | PubMed ID:18467156 | HubMed [4]
  3. Le LQ, Mahler V, Lorenz Y, Scheurer S, Biemelt S, Vieths S, and Sonnewald U. Reduced allergenicity of tomato fruits harvested from Lyc e 1-silenced transgenic tomato plants. J Allergy Clin Immunol. 2006 Nov;118(5):1176-83. DOI:10.1016/j.jaci.2006.06.031 | PubMed ID:17088146 | HubMed [5]
  4. Gallo M and Sayre R. Removing allergens and reducing toxins from food crops. Curr Opin Biotechnol. 2009 Apr;20(2):191-6. DOI:10.1016/j.copbio.2009.03.005 | PubMed ID:19356919 | HubMed [6]
  5. Lorenz Y, Enrique E, Lequynh L, Fötisch K, Retzek M, Biemelt S, Sonnewald U, Vieths S, and Scheurer S. Skin prick tests reveal stable and heritable reduction of allergenic potency of gene-silenced tomato fruits. J Allergy Clin Immunol. 2006 Sep;118(3):711-8. DOI:10.1016/j.jaci.2006.05.014 | PubMed ID:16950292 | HubMed [7]
  6. Herman EM, Helm RM, Jung R, and Kinney AJ. Genetic modification removes an immunodominant allergen from soybean. Plant Physiol. 2003 May;132(1):36-43. DOI:10.1104/pp.103.021865 | PubMed ID:12746509 | HubMed [8]
  7. Gilissen LJ, Bolhaar ST, Matos CI, Rouwendal GJ, Boone MJ, Krens FA, Zuidmeer L, Van Leeuwen A, Akkerdaas J, Hoffmann-Sommergruber K, Knulst AC, Bosch D, Van de Weg WE, and Van Ree R. Silencing the major apple allergen Mal d 1 by using the RNA interference approach. J Allergy Clin Immunol. 2005 Feb;115(2):364-9. DOI:10.1016/j.jaci.2004.10.014 | PubMed ID:15696096 | HubMed [9]
  8. Bhalla PL and Singh MB. Knocking out expression of plant allergen genes. Methods. 2004 Mar;32(3):340-5. DOI:10.1016/j.ymeth.2003.08.011 | PubMed ID:14962769 | HubMed [10]
All Medline abstracts: PubMed | HubMed

Allergen proteins

  1. Chardin H, Mayer C, Sénéchal H, Wal JM, Poncet P, Desvaux FX, and Peltre G. Lipid transfer protein 1 is a possible allergen in Arabidopsis thaliana. Int Arch Allergy Immunol. 2003 Jun;131(2):85-90. DOI:70923 | PubMed ID:12811016 | HubMed [11]
  2. San Miguel-Moncín M, Krail M, Scheurer S, Enrique E, Alonso R, Conti A, Cisteró-Bahíma A, and Vieths S. Lettuce anaphylaxis: identification of a lipid transfer protein as the major allergen. Allergy. 2003 Jun;58(6):511-7. PubMed ID:12757453 | HubMed [12]
  3. Salcedo G, Sanchez-Monge R, Diaz-Perales A, Garcia-Casado G, and Barber D. Plant non-specific lipid transfer proteins as food and pollen allergens. Clin Exp Allergy. 2004 Sep;34(9):1336-41. DOI:10.1111/j.1365-2222.2004.02018.x | PubMed ID:15347364 | HubMed [13]
  4. Gajhede M, Osmark P, Poulsen FM, Ipsen H, Larsen JN, Joost van Neerven RJ, Schou C, Løwenstein H, and Spangfort MD. X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy. Nat Struct Biol. 1996 Dec;3(12):1040-5. PubMed ID:8946858 | HubMed [14]
  5. Zuidmeer L, Salentijn E, Rivas MF, Mancebo EG, Asero R, Matos CI, Pelgrom KT, Gilissen LJ, and van Ree R. The role of profilin and lipid transfer protein in strawberry allergy in the Mediterranean area. Clin Exp Allergy. 2006 May;36(5):666-75. DOI:10.1111/j.1365-2222.2006.02453.x | PubMed ID:16650053 | HubMed [15]
  6. Karlsson AL, Alm R, Ekstrand B, Fjelkner-Modig S, Schiött A, Bengtsson U, Björk L, Hjernø K, Roepstorff P, and Emanuelsson CS. Bet v 1 homologues in strawberry identified as IgE-binding proteins and presumptive allergens. Allergy. 2004 Dec;59(12):1277-84. DOI:10.1111/j.1398-9995.2004.00585.x | PubMed ID:15507096 | HubMed [16]
  7. Musidlowska-Persson A, Alm R, and Emanuelsson C. Cloning and sequencing of the Bet v 1-homologous allergen Fra a 1 in strawberry (Fragaria ananassa) shows the presence of an intron and little variability in amino acid sequence. Mol Immunol. 2007 Feb;44(6):1245-52. DOI:10.1016/j.molimm.2006.06.004 | PubMed ID:16945416 | HubMed [17]
  8. Breiteneder H and Ebner C. Molecular and biochemical classification of plant-derived food allergens. J Allergy Clin Immunol. 2000 Jul;106(1 Pt 1):27-36. DOI:10.1067/mai.2000.106929 | PubMed ID:10887301 | HubMed [18]
  9. Jensen-Jarolim E, Schmid B, Bernier F, Berna A, Kinaciyan T, Focke M, Ebner C, Scheiner O, and Boltz-Nitulescu G. Allergologic exploration of germins and germin-like proteins, a new class of plant allergens. Allergy. 2002 Sep;57(9):805-10. PubMed ID:12169176 | HubMed [19]
All Medline abstracts: PubMed | HubMed

Primers and Sequences

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer
Fra a 1 Exon2 (for hair pin) CCTTGAATTCGCGGCCGCATCTAGA acgtcaagcacaagatccac AAGGCTGCAGCGGCCGCTACTAGT gtggatcttgtgcttgacgt AAGGCTGCAGCGGCCGCTACTAGT acgtcaagcacaagatccac CCTTGAATTCGCGGCCGCATCTAGA gtggatcttgtgcttgacgt


Isolating Genes From Plants

Strawberry Transformation

  1. Schaart JG, Krens FA, Pelgrom KT, Mendes O, and Rouwendal GJ. Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol J. 2004 May;2(3):233-40. DOI:10.1111/j.1467-7652.2004.00067.x | PubMed ID:17147614 | HubMed [1]
  2. Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, and Shulaev V. High-efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics. Planta. 2006 May;223(6):1219-30. DOI:10.1007/s00425-005-0170-3 | PubMed ID:16320068 | HubMed [2]
  3. Husaini AM. Pre- and post-agroinfection strategies for efficient leaf disk transformation and regeneration of transgenic strawberry plants. Plant Cell Rep. 2010 Jan;29(1):97-110. DOI:10.1007/s00299-009-0801-4 | PubMed ID:19956955 | HubMed [3]
  4. Graham J, McNicol RJ, and Kumar A. Agrobacterium-mediated transformation of soft fruit Rubus, Ribes, and Fragaria. Methods Mol Biol. 1995;44:129-33. DOI:10.1385/0-89603-302-3:129 | PubMed ID:7581659 | HubMed [4]
All Medline abstracts: PubMed | HubMed



ihpRNA production requires the selection of an intron. Here's one (between || in the range 295..396): D64156.1

        1 tgtagtaatg tgtatatata ggtggtcgtg ttacgcgagg aggaacacag caaactcatc
       61 aaatctgggg ttgacaagaa tctggtactg tctacaagca atagttatta ctccccaaag
      121 gtgtggttgg tgggggatgg aatagagaac gaagagcaga tgaaagcaaa agaaggaacc
      181 ctctttgttc ccttttctca ctttccgccc aacaaactcc gcaaggactg tttctaccag
      241 tccactccag ctatgcgtgt tcccaagtct gcccaaaaca tcgactcctg tgag|gtacat
      301 ctttgaattc ttatagatat atctgtaact tttatattat ataagctgat agatgtgttc
      361 atctataatg aatgaatggt tgttatatat atatag|aact ggctggggag gagggtgatg
      421 agtgcatgga aaataggagg tatagtgcat gcacttgagg gttgggagga gcatgactgc
      481 ggcaacactt gcaacgtcct ccgtctccac gccatatggg aagctgctct tcgccatgat
      541 ttccaacctc tcccaccatc tcctctatga gcttttttca tattcataca tctatgtccc
      601 ct
  1 ttttatctat ctttttattt tcttgtgtgg attgcttgtg attttgtttg ttggcctaat
       61 aatcagcttg gattttttag ctttcttgga aataaaagaa gatcacgata attaattact
      121 ttatggtccc aacctacaaa ttgttggact actattggaa ctaacaaata aatacacgaa
      181 attgattggg tgagttataa tattaccttt ttagtttttg atatagtcaa attttatagt
      241 ataacagatt tgttaaaatt aaattgtatc gaaacttctt atagtaatgt actaatgtga
      301 gaaaatctgt gtactgttat tatagtatac gcgttttaat acttttatta ttattcctac
      361 ttaaagaaaa taccaaatat ttttccgttt tttgggtgtg tttagttctt ttttttttaa
      421 ctgaaggatt ttggtgaatt ttctgttgcc attaaaaata tttgtgttta gttttttgat
      481 attttaattc tttacttttt tttaagataa tcaatgwwgg accaacatcc caaatgtgaa
      541 ccaaactccg acccgaaanc cgctgctttc aatactttca atcgaaatag cgtgtgacgt
      601 gtgttaatat ctgcatgcat tgattatcgg acaatgacaa atattctatt tatcctaaat
      661 tttattctcc gtgaagtaca catttggaca aaccaaacgt agatttgaga aaaaaatgcg
      721 gaaaacccaa agtctatccg tggcgaagaa taagaggcaa aaacggggaa tataacccaa
      781 agtctaaacc caataattat tttattgata atcaaaatct atcacgagaa agacgacgtt
      841 ttgacatctc agtcgttata aatttcaata aattatgttt cccttgaact gattcacatg
      901 tcattttcat tccacatata tacgccaatc gtgtaatctt ttagattatc gatcgaacat
      961 ctaaattttg tcaacatgtt aatgaatatc taaggaacgc tatcgsstat cgcttttttc
     1021 aacataagtc taatttgaga gatgttaatc caccgcatgt tgagtggtgt aagagagaaa
     1081 gagccgccac taggctactt gtctcccaac aacaatatat atcctgaatt atgaattatg
     1141 caattatact tttctggtca ttcaattatt attacttttg ttttgttcaa aatgctttag
     1201 tgtactactt tcaaatttca acatccttct ttatttattt caactttttt ctcaacatta
     1261 tcgtttcttt tttsctgtcg ataacaacaa cttgttgagt gtcttgcaaa gattagcctt
     1321 ttactcgatt ccccgtttga ttagatttta aggctttccg ttaaccttta acagttaaca
     1381 aagtgtggag tgcctagcaa agacaattgt gctttgtkky ggcggcaacg tcagcaacgr
     1441 ttttaggact tctacttctg atgagagata cagakcgttg ccwygttgaa aaagaaatta
     1501 aaaggaaaac ataacacatt atacgagaaa gaagtttaaa aaaaaaaaaa actggttgaa
     1561 actaatcgaa tatttgaagc attttttata tctactagaa agtaagtttt ttaatggcta
     1621 aaaacgaata atcctattca ttattttaar tcaaacacta ataagatgtt cttaaacatt
     1681 tcaactagtt aaccccattg ttttccctct atatatatac cccaccaagg cacaaaccaa
     1741 cccactcact cacattattt aaaacacatg ttttactact tgtctacata tatctatata
     1801 atcatcgtag aaatcgatac ttgaggccag cccaaaatca cactcgagtc gaatatatat
     1861 atatatatat atatcttaat ccggctcgtt atataaaagc tccagacttg tcactagggt
     1921 tgccgtcaga ttttgtgatc atggagtttc gtcaaccaaa cgcaacagca ttgagcgacc
     1981 cacttaactg gaatgtagcg gcggaggctt taaaagggag ccacctggag gaggtgaaga
     2041 agatggtgaa ggattatagg aaaggaacgg tgcagctagg cggagagacg ctgaccatcg
     2101 gtcaggttgc ggcagtagcg agtggaggag gaccgacagt ggagctttct gaggaggctc
     2161 ggggcggtgt gaaggcgagt agtgactggg tgatggagag catgaaccgt gatacggaca
     2221 catatgggat caccactgga tttggttcat cttctcgtag gaggactgac caaggtgctg
     2281 ctcttcaaaa agagcttatt aggtaatt|ca tattcatagt tgaatcagac gaaaaataaa
     2341 tagaatcata gaaaactagg tttagaaacc cgtacataaa ctagtttttt taaaaaggaa
     2401 tssatattta tatccagcgc ctatagataa agaacaagac attttataat ctgtctcgac
     2461 gtttttacac caacaaatga gaataattag tcgtactata aaagttcaaa tttctttaaa
     2521 tatgattaaa cgaagactaa aacgctctaa gttttactac atttttaaat aaatacgact
     2581 ttttgccgaa agaaaacata gtacttaaga taagagcatt ttgtgttcta atgaaaatta
     2641 aacgtttctg cattctctat tcttttgact gtcttatact tttattgaaa taagcttttt
     2701 ttaacttttg taaatcagct ttaacgaaaa aagaatgtag tgactagtgg agcacggagg
     2761 caaagttgct agctttgtac accttttttt tatttttgtc ttttgggttg taacttagat
     2821 aagaagaggt ctcagtccgt aaaaagttta aacggtatcg attaaaattg tttaagctaa
     2881 aagaggtagt agtcgaagtt attaaatgca ttatattata tagttgacaa aagtaattaa
     2941 aaaataaatg taatcggttt aaaactgacg gatcccaaat tatatcaacc ag|gtatttga
     3001 acgccgggat attcgctacc ggcaacgaag atgacgacag gtcaaacacg cttccccggc
     3061 cggctactag agcagcgatg ctcatccgtg taaacaccct cctccaaggc tactctggta
     3121 tacgctttga gatcctcgaa gccatcacaa cactcctcaa ctgcaaaatt acaccgctcc
     3181 ttcctctccg aggcaccatt accgcctccg gggatctcgt tccgttatcc tatatcgctg
     3241 gattcctcat cgggcgcccc aactcccgat ccgtgggccc ctctggcgag atcctcactg
     3301 ccttggaggc cttcaagctc gctggagtat cgtctttttt cgaactcagg cctaaagaag
     3361 ggcttgcgct cgtgaatggg actgcggtgg ggtctgcttt agcctctacg gtactgtacg
     3421 atgccaacat tttggtggtt ttctccgaag ttgcttccgc catgtttgca gaggttatgc
     3481 aggggaaacc agagtttacc gatcatctta cgcataaact caagcaccat cctggtcaga
     3541 tcgaagccgc cgctatcatg gagcatattc tagacggaag ctcttatgta aaagaagctc
     3601 tacatctcca caagattgat ccgcttcaga aacctaaaca agatcggtat gttcttgggt
     3661 atcaagcaac tagtttcttg taactcaagt aacccttttg atttgctttc tgattaaatt
     3721 gacttatagt ttcgtgttta aattaacagt tacgctctgc gaacatctcc gcaatggctt
     3781 ggaccgcaga ttgaggtgat aagagcagcg actaagatga tcgaacgtga gataaactca
     3841 gtaaacgata accctttgat cgatgtttca agaaacaaag ctatccatgg tgggaacttc
     3901 caggggacac caattggtgt cgccatggat aacactcgtc tagcacttgc ttctatcggg
     3961 aagctaatgt tcgctcagtt cactgaactc gtaaatgatt tctacaacaa cgggttaccc
     4021 tctaatctat ctggtggtag aaaccctagt cttgattacg ggttaaaagg cgcagaagtc
     4081 gccatggctt cttattgctc agagcttcag ttcctagcaa atcctgtgac gaaccatgtc
     4141 gaaagcgctt ctcaacacaa tcaagatgtt aactctcttg ggctgatctc gagccgaacg
     4201 acagcagaag ctgtggttat cctcaagctc atgtcaacga cttacttggt agctttgtgc
     4261 caagcctttg atctgagaca ccttgaagaa attctcaaga aagcggttaa tgaggttgtg
     4321 agccacactg ccaaaagcgt tctagcaatc gaaccattcc gcaaacacga cgatattctt
     4381 ggagttgtca accgcgaata cgtcttctcc tatgttgatg acccaagcag cctcactaac
     4441 cctttaatgc agaagctgag acatgtcctc ttcgacaaag ctttagctga accggaaggc
     4501 gagaccgaca cggtttttcg gaaaatcgga gcgttcgagg ccgagctgaa atttctcctc
     4561 cctaaagaag tggaacgagt caggacagag tacgagaacg gtacatttaa tgtggctaac
     4621 cgaatcaaga agtgtcgatc gtatccgctg taccggtttg tgcggaatga actcgagacg
     4681 aggttgctaa ccggagagga tgttcggtca ccgggagagg attttgacaa agtcttcagg
     4741 gctatatctc aaggaaaact catagawcct ctgtttgaat gtctgaaaga gtggaacggt
     4801 gctccgattt ctatctgcta aaacgtttcg tcagatctcc atatatcgag aataataaac
     4861 acaccattcg aaaatatttg gttgtgtagt aatcgtcttg ccttcgcctt ttcaataatg
     4921 tcctg