Difference between revisions of "IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28"

From OpenWetWare
Jump to: navigation, search
(Team Allergy)
(Team Allergy)
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
 
==Team Allergy==
 
==Team Allergy==
 +
===Protocol===
  
 
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.  
 
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.  
  
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow.  
+
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).  
  
*Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
+
#Culture colonies  
**''Concentrations''
+
#Miniprep
 +
#Nanodrop
 +
#Digest false negatives
 +
#Ligate
 +
#Transform
 +
 
 +
===Results===
 +
 
 +
'''Nanodrop'''
 +
 
 +
The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2.
 +
All these working ligations are with the PAL intron
 +
 
 +
#9, LTP, 97.9, 94.1
 +
#11, LTP, 77.9, 94.8
 +
#25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
 +
#28, Bet v2, 73.2, 83.6
 +
#36, Ger3, 76.1, 83.4
 +
#37, Ger3, 70.0, 75.3
 +
#38, Ger3, 90.4, 108.3
  
 
*Transformed more sense+pdk parts for our false negatives (16,30,31)
 
*Transformed more sense+pdk parts for our false negatives (16,30,31)

Revision as of 12:02, 30 July 2010

Igem-logo-150px.png iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Allergy

Protocol

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).

  1. Culture colonies
  2. Miniprep
  3. Nanodrop
  4. Digest false negatives
  5. Ligate
  6. Transform

Results

Nanodrop

The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron

  1. 9, LTP, 97.9, 94.1
  2. 11, LTP, 77.9, 94.8
  3. 25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
  4. 28, Bet v2, 73.2, 83.6
  5. 36, Ger3, 76.1, 83.4
  6. 37, Ger3, 70.0, 75.3
  7. 38, Ger3, 90.4, 108.3
  • Transformed more sense+pdk parts for our false negatives (16,30,31)

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

ValPfxConfirm.jpg

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
PhusionDetails.png PhusionCycle.png
An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation
004017PCRconfirm.jpg

  1. Ladder
  2. J45004 PCR #1
  3. J45004 PCR #2
  4. J45017 PCR #1
  5. J45017 PCR #2
  6. Ladder
  • Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
  • The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success! Barnase pstxba gel ext 7-28.jpg