IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
m (New page: 6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. The oligos ordered were as follows: Construct 1 5’- GTTTC...) |
(No difference)
|
Revision as of 14:07, 27 June 2007
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
