
From OpenWetWare
Revision as of 12:03, 21 August 2006 by Lhahn (talk | contribs) (Strand Displacement Oligos)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


  • Oligos (8 ssDNA sequences):

SN = streptavidin aptamer + N bp 3' tail

TN = thrombin aptamer + N bp 3' tail

















  • Alignment


3'                                              TCGTAGATCTCCAAGTCACAGGTTGGTGTGGTTGG    5'


3'                                              TCGTAGATCTCCAAGTGAAGACGTCGTTATTCACAGGTTGGTGTGGTTGG      5'        


















  • Alignment







Biotinylated oligos

Biotinylated oligos as positive control in viscosity experiment:

5' and 3' biotinylated:



5' biotinylated:





Strand Displacement Oligos






