IGEM:Hong Kong HKUST/Primers

From OpenWetWare
Revision as of 06:04, 13 October 2008 by Jean Wang (talk | contribs)
Jump to: navigation, search

EcoRI_T7P: GC GAA TTC TAATACGACTCACTATAGGG

4_XhoI:

7_followup_1:

7_followup_2:

19_new_up:

20_up:

21_up:


Primers
Number Name Sequence Tm Date

...