Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 78: | Line 78: | ||
| MAFA || treated cells || MAFA | | MAFA || treated cells || MAFA | ||
|- | |- | ||
| GLP1R || | | GLP1R || NM_002062.3 || cacttggagctaattaaggtttgc || ccgtccagtctttctgctgt | ||
|- | |- | ||
| PCSK1 || treated cells || PCSK1 | | PCSK1 || treated cells || PCSK1 | ||
|- | |- |
Revision as of 10:46, 4 November 2013
Haynes BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|