Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(fix raw html notebook nav) |
|||
(14 intermediate revisions by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Haynes BioBrick Cloning</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Haynes BioBrick Cloning</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 24: | Line 24: | ||
| Rxn 4: || treated cells || PCSK1 | | Rxn 4: || treated cells || PCSK1 | ||
|- | |- | ||
| Rxn 5: || treated cells || | | Rxn 5: || treated cells || IAPP | ||
|- | |- | ||
| Rxn 6: || | | Rxn 6: || treated cells || KCNQ2 | ||
|- | |- | ||
| Rxn 7: || | | Rxn 7: || treated cells || GAPD (reference gene) | ||
|- | |- | ||
| Rxn 8: || untreated cells || | | Rxn 8: || untreated cells || PDX1 | ||
|- | |- | ||
| Rxn 9: || untreated cells || | | Rxn 9: || untreated cells || MAFA | ||
|- | |- | ||
| Rxn 10: || untreated cells || | | Rxn 10: || untreated cells || GLP1R | ||
|- | |- | ||
| Rxn 11: || | | Rxn 11: || untreated cells || PCSK1 | ||
|- | |- | ||
| Rxn 12: || | | Rxn 12: || untreated cells || IAPP | ||
|- | |- | ||
| Rxn 13: || | | Rxn 13: || untreated cells || KCNQ2 | ||
|- | |- | ||
| Rxn 14: || | | Rxn 14: || untreated cells || GAPD (reference gene) | ||
|- | |- | ||
| Rxn 15: || no template || GAPD (reference gene) | | Rxn 15: || no template || PDX1 | ||
|- | |||
| Rxn 16: || no template || MAFA | |||
|- | |||
| Rxn 17: || no template || GLP1R | |||
|- | |||
| Rxn 18: || no template || PCSK1 | |||
|- | |||
| Rxn 19: || no template || IAPP | |||
|- | |||
| Rxn 20: || no template || KCN2Q | |||
|- | |||
| Rxn 21: || no template || GAPD (reference gene) | |||
|} | |} | ||
Line 51: | Line 63: | ||
*Using Variation 2 | *Using Variation 2 | ||
Variation 2<br> [[Image:Haynes_UPL_fig2.png|300px|Figure 1]] | Variation 2<br> [[Image:Haynes_UPL_fig2.png|300px|Figure 1]] | ||
*Using as Reference, discount gene names on left side | |||
==Primers== | |||
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3 | |||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''PRIMERS LIST''' | |||
{| width= 700px | |||
|- | |||
| || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe''' | |||
|- | |||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001 | |||
|- | |||
| MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001 | |||
|- | |||
| GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001 | |||
|- | |||
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag || #1, cat.no. 04684974001 | |||
|- | |||
| IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc || #77, cat.no. 04689003001 | |||
|- | |||
| KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001 | |||
|- | |||
| GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001 | |||
|} | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
__NOTOC__ | __NOTOC__ |
Latest revision as of 23:30, 26 September 2017
Haynes BioBrick Cloning | Main project page Previous entry Next entry | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|