Difference between revisions of "Harvard:Biophysics 101/2007/Notebook:Resmi Charalel/2007-3-15"

From OpenWetWare
Jump to: navigation, search
(Task 1)
(Task 1)
Line 1: Line 1:
 
==Task 1==
 
==Task 1==
 
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
 
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
**This sequence corresponds to Homo sapiens chromosome 10 genomic contig, reference assembly and contains a 1bp point mutation at position 201 of the given sequence, which corresponds to position 42969070 in reference sequence.  
+
**This sequence corresponds to Homo sapiens chromosome 10 genomic contig, reference assembly and contains a 1bp point mutation (G to A) at position 201 of the given sequence, which corresponds to position 42969070 in reference sequence.  
 
**The consequences of this mutation are that...
 
**The consequences of this mutation are that...

Revision as of 12:47, 13 March 2007

Task 1

  • Manual analysis of provided sequence: CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC
    • This sequence corresponds to Homo sapiens chromosome 10 genomic contig, reference assembly and contains a 1bp point mutation (G to A) at position 201 of the given sequence, which corresponds to position 42969070 in reference sequence.
    • The consequences of this mutation are that...