Difference between revisions of "Harvard:Biophysics 101/2007/Notebook:Resmi Charalel/2007-3-15"

From OpenWetWare
Jump to: navigation, search
(Task 1)
(Task 1)
Line 1: Line 1:
 
==Task 1==
 
==Task 1==
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC
+
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
CGGCGCTCCCACGCGAAGC  
 
 
**dsf
 
**dsf
  
 
***j
 
***j

Revision as of 11:55, 13 March 2007

Task 1

  • Manual analysis of provided sequence: CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC
    • dsf
      • j