Difference between revisions of "Harvard:Biophysics 101/2007/Notebook:Michael Wang/2007-3-15"

From OpenWetWare
Jump to: navigation, search
Line 1: Line 1:
 
The first thing I did was identify the orfs in the sequence.  I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf.  Pretty short.   
 
The first thing I did was identify the orfs in the sequence.  I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf.  Pretty short.   
 
+
<pre>
 
>example1 <BR>                                                                     
 
>example1 <BR>                                                                     
 
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG<BR>                     
 
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG<BR>                     
Line 9: Line 9:
 
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC<BR>                     
 
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC<BR>                     
 
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC<BR>   
 
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC<BR>   
 
+
</pre>
  
 
This is useless without some comparison so I blasted it.
 
This is useless without some comparison so I blasted it.

Revision as of 19:52, 14 March 2007

The first thing I did was identify the orfs in the sequence. I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf. Pretty short.

>example1 <BR>                                                                     
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG<BR>                    
C'''ATG'''CCACCCACAACAACTTTT'''TAA'''AAGAATCAGACGTGTGAAGGATTCTATTCGAATTA<BR>                    
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC<BR>                    
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT<BR>                    
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG<BR>                    
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC<BR>                    
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC<BR>   

This is useless without some comparison so I blasted it.