Difference between revisions of "Hartings AU Photosynthesis Lab:Materials/Hemoglobin/WT Sequence text"

From OpenWetWare
Jump to: navigation, search
 
Line 1: Line 1:
 
{{Template:Hartings AU Photosynthesis Lab}}
 
{{Template:Hartings AU Photosynthesis Lab}}
 
<div style="margin-left: 40px; width: 750px">
 
<div style="margin-left: 40px; width: 750px">
AATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA
+
ATGGCTAATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA

Latest revision as of 07:28, 14 January 2013

Hartings AU Photosynthesis Lab Header.png


ATGGCTAATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA