Difference between revisions of "Hartings AU Photosynthesis Lab:Materials/Hemoglobin/M8SM33SM103S Sequence text"

From OpenWetWare
Jump to: navigation, search
(New page: {{Template:Hartings AU Photosynthesis Lab}} AATAAAACGAGAGAACTATGCAGCAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGCATCGACCTTTACAAACATAGCTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGA...)
(No difference)

Revision as of 11:06, 14 January 2013

Hartings AU Photosynthesis Lab Header.png


AATAAAACGAGAGAACTATGCAGCAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGCATCGACCTTTACAAACATAGCTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATAGCCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA