Difference between revisions of "Hartings AU Photosynthesis Lab:Materials/Hemoglobin/K31C Sequence text"

From OpenWetWare
Jump to: navigation, search
(New page: ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTT...)
 
 
Line 1: Line 1:
 +
{{Template:Hartings AU Photosynthesis Lab}}
 +
 
ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA
 
ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA

Latest revision as of 07:27, 14 January 2013

Hartings AU Photosynthesis Lab Header.png


ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA