Difference between revisions of "Hartings AU Photosynthesis Lab:Materials/Hemoglobin/K31C Sequence text"

From OpenWetWare
Jump to: navigation, search
(New page: ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTT...)
(No difference)

Revision as of 08:26, 14 January 2013

ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA