Difference between revisions of "Berk2006-Oligos"

From OpenWetWare
Jump to: navigation, search
Line 38: Line 38:
|2005iGEM12 || TraJR-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
|2005iGEM12 || TraJR-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
Line 48: Line 48:
|2005iGEM18 || FTJiamF || ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
|2005iGEM19 || FORlamF || tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
|2005iGEM19 || FORlamF || tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
Line 92: Line 92:

Revision as of 16:35, 9 June 2006

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa