BME494s2013 Project Team1: Difference between revisions
No edit summary |
|||
Line 101: | Line 101: | ||
<!-- Illustrate and describe how you will build your lac switch. Incorporate information from Group Presentation 2 --> | <!-- Illustrate and describe how you will build your lac switch. Incorporate information from Group Presentation 2 --> | ||
Emily | (Emily) The assembly strategy employed in the design of this device is a Type IIS assembly strategy. The steps and procedures involved in this single-pot assembly are described below. | ||
===Mutagenesis=== | |||
One of the parts chosen by our group contains a BsmBI cut site, which would disrupt the digestion and ligation process further along the assembly strategy. In order to counteract this, the part is subjected to mutagenesis to alter a selected base pair within the DNA to eliminate the BsmBI cut site while keeping the integrity of the coding sequence intact. | |||
This site-directed base substitution is performed using two primers with centrally located substitution sites to alter the selected base pair on a methylated plasmid. | |||
After the part has completed the mutagenesis, the DNA sequence (which is linear at this point in time) undergoes ''in vitro'' recombination reaction. The host cell then "circularizes" the mutated part DNA and digests the original methylated plasmid. If the methylation of the original plasmid is skipped, an additional purification step would be necessary to extract the mutated plasmid. | |||
===PCR== | |||
PCR, or polymerase chain reaction, is then used to amplify the DNA sequences and create modular fragments for ease of assembly. | |||
A DNA fragment is combined with its forward and reverse primers, nucleotides, and DNA polymerase. This mixture is then inserted into a thermal cycler, which cycles the internal temperature with predetermined values. These changes in temperature cause the DNA to separate, the primers to pair with their respective DNA strands, the DNA polymerase to activate, and a new DNA strand to be formed. | |||
The thermal cycling is continued until the specified fragment is amplified sufficiently for use. | |||
===Digestion and ligation reaction=== | |||
The Type IIS assembly strategy employs a single-pot assembly, wherein digestion and ligation occur in tandem. To prevent the futile digestion/ligation loop that could result from this assembly strategy, the BsmBI restriction enzyme is used. BsmBI is useful in this scenario because its binding site is remote from its cutting site. | |||
In the digestion and ligation reaction, BsmBI binds to its binding site, ''CGTCTC'', and cuts at a location further along the DNA strand. This creates a 4 base pair "sticky overhang." Complementary "sticky overhangs" then pair up and are connected by the ligase. | |||
===Parts and primers=== | |||
{| border="1" class="wikitable" | |||
|+ BioBrick parts used in the device assembly | |||
! Name | |||
! ID | |||
! Size | |||
|- | |||
! IPTG inducible ''lac'' promoter cassette [Brick 1] | |||
| BBa_K418003 | |||
| 1416 bp | |||
|- | |||
! RBS + CFPlva + term. X2 [Brick 2] | |||
| BBa_K411225 | |||
| 917 bp | |||
|- | |||
! BioBrick plasmid backbone [Vector] | |||
| pSB1A3 | |||
| 2155 bp | |||
|} | |||
{| border="1" class="wikitable" | |||
|+ Primers used in the device assembly | |||
! Part/Purpose | |||
! Forward (5' to 3') | |||
! Reverse (5' to 3') | |||
|- | |||
! [Brick 1] | |||
| CACACCACGTCTCATAGATTGACAGCTAGCTCA | |||
| CACACCACGTCTCATGTGCTCAGTATCTT | |||
|- | |||
! [Brick 2] | |||
| CACACCACGTCTCAAAAGAGGAGAAATAC | |||
| CACACCACGTCTCATAGTTATAAACGCAGAAAG | |||
|- | |||
! [Vector] | |||
| CACACCACGTCTCAACTAGTAGCGGCCGC | |||
| CACACCACGTCTCATCTAGATGCGGCCGC | |||
|- | |||
! [Brick 1] Mutagenesis | |||
| ATCAGCTGTTGCCCGCCTCACTGGTGAAAAG | |||
| TCTTTTCACCAGTGAGGCGGGCAACAGCTGA | |||
|} | |||
===Assembly=== | |||
{| border="1" class="wikitable" | |||
|+ Primers used in the device assembly | |||
! Reagent | |||
! [Brick 1] | |||
! [Brick 2] | |||
! [Vector] | |||
|- | |||
! Template DNA | |||
| 0.2 μL | |||
| 0.2 μL | |||
| 0.2 μL | |||
|- | |||
! 10 μM Forward Primer | |||
| 1.0 μL | |||
| 1.0 μL | |||
| 1.0 μL | |||
|- | |||
! 10 μM Reverse Primer | |||
| 1.0 μL | |||
| 1.0 μL | |||
| 1.0 μL | |||
|- | |||
! 2x GoTaq Green Mix | |||
| 25 μL | |||
| 25 μL | |||
| 25 μL | |||
|- | |||
! H<sub>2</sub>O | |||
| 22.8 μL | |||
| 22.8 μL | |||
| 22.8 μL | |||
|- | |||
! Total Volume | |||
| 50 μL | |||
| 50 μL | |||
| 50 μL | |||
|} | |||
<br><br><br><br><br><br><br><br><br><br><br><br> | <br><br><br><br><br><br><br><br><br><br><br><br> |
Revision as of 15:31, 28 April 2013
Home People Course Projects Course Materials Schedule Photos Wiki Editing Help
Overview & PurposeSarah
Background
"Only LacZ and LacY appear to be necessary for lactose catabolism" [3].
Design: Our genetic circuitJulia Our gene switchParts<tab>pSB1A3-1 is a high copy number plasmid. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell). The terminators bracketing pSB1A3 MCS are designed to prevent transcription from inside the MCS from reading out into the vector.
Building: Assembly scheme(Emily) The assembly strategy employed in the design of this device is a Type IIS assembly strategy. The steps and procedures involved in this single-pot assembly are described below. MutagenesisOne of the parts chosen by our group contains a BsmBI cut site, which would disrupt the digestion and ligation process further along the assembly strategy. In order to counteract this, the part is subjected to mutagenesis to alter a selected base pair within the DNA to eliminate the BsmBI cut site while keeping the integrity of the coding sequence intact. This site-directed base substitution is performed using two primers with centrally located substitution sites to alter the selected base pair on a methylated plasmid. After the part has completed the mutagenesis, the DNA sequence (which is linear at this point in time) undergoes in vitro recombination reaction. The host cell then "circularizes" the mutated part DNA and digests the original methylated plasmid. If the methylation of the original plasmid is skipped, an additional purification step would be necessary to extract the mutated plasmid. =PCRPCR, or polymerase chain reaction, is then used to amplify the DNA sequences and create modular fragments for ease of assembly. A DNA fragment is combined with its forward and reverse primers, nucleotides, and DNA polymerase. This mixture is then inserted into a thermal cycler, which cycles the internal temperature with predetermined values. These changes in temperature cause the DNA to separate, the primers to pair with their respective DNA strands, the DNA polymerase to activate, and a new DNA strand to be formed. The thermal cycling is continued until the specified fragment is amplified sufficiently for use. Digestion and ligation reactionThe Type IIS assembly strategy employs a single-pot assembly, wherein digestion and ligation occur in tandem. To prevent the futile digestion/ligation loop that could result from this assembly strategy, the BsmBI restriction enzyme is used. BsmBI is useful in this scenario because its binding site is remote from its cutting site. In the digestion and ligation reaction, BsmBI binds to its binding site, CGTCTC, and cuts at a location further along the DNA strand. This creates a 4 base pair "sticky overhang." Complementary "sticky overhangs" then pair up and are connected by the ligase. Parts and primers
Assembly
Testing: Modeling and GFP imaging
A lac switch modelWe used a previously published synthetic switch, developed by Ceroni et al.[5], to understand how our system could potentially be modeled and simulated. The graphic to the left depicts the relationships between the parameters of the lac operon switch described by Ceroni using a network diagram illustration. The parameters shown in the illustration relate to cell processes and could be used in forming a cohesive mathematical model of the cell's operation. In order to approximate the behavior of this set-up, a mathematical model can be developed based upon the relationships between the processes found in the cell. These relationships can be expressed in mathematical terms using numbers that relate to the system, including creation or decay rates, concentrations, or various constants. The actual values for these parameters can be sourced from experimentation, literature, or a predefined steady-state. If a model is well-defined and the necessary parameters known, a person may use the model to ascertain the state of a cell at a given point in time. For example, if an experimenter wanted to know the decay of the GFP protein molecules at a given point in time in a single cell, the following equation could be written using the notation found in the table below. Decay = G × λG/L The formula takes the concentration of the GFP protein in molecules per cell ("G") and multiplies it by the protein degradation rate in minutes-1 ("λG/L"). This results in a decay value for GPF in molecules per minute per cell. The Ceroni et al. model and the network diagram illustration use the table of variables and parameters seen below in their representation of the lac switch. The variables related to a particular cell process are located near to that process in the network diagram illustration.
An interactive modelWe used a model of the natural Lac operon to understand how changing the parameter values changes the behavior of the system. By changing the initial concentration of input (IPTG in this case), we were able to estimate the threshold that produces an "on" state in the system. Initially, the code had the concentration at 0.32 which is seen in the β-galactoside (Bgal concentration) vs. time plot (Figure 1). This value was changed again to 0.25 in determining the threshold that produces this "on" state (Figure 2). After proceeding to go up and down with these a values, a threshold was indeed found where the concentration of IPTG is about 0.064 (Figure 3).
Collecting imperical values to improve the modelSarah
Stakeholder Assessment
SUPPORTS & UNDERSTANDS
Our Team
Works Cited |