BME103 s2013:T900 Group4 L3: Difference between revisions
Anna Essex (talk | contribs) |
Anna Essex (talk | contribs) |
||
Line 144: | Line 144: | ||
<br> | <br> | ||
Rather than drastically change a fairly-efficient PCR machine, we decided that the fluorimeter setup was more in need of modification. The only change to the PCR machine would be improved USB ports, but the fluorimeter would have a built-in camera to remove the complications of positioning a camera phone. The phone would still be used to run the machine, but it wouldn't directly take the pictures. This new camera would take the place of the current cradle and be at a fixed position in respects to the fluorimeter for most efficient photographing. Also, the slots on the board of the fluorimeter would be labeled to avoid confusion in the process of analysis. | Rather than drastically change a fairly-efficient PCR machine, we decided that the fluorimeter setup was more in need of modification. The only change to the PCR machine would be improved USB ports, but the fluorimeter would have a built-in camera to remove the complications of positioning a camera phone. The phone would still be used to run the machine, but it wouldn't directly take the pictures. This new camera would take the place of the current cradle and be at a fixed position in respects to the fluorimeter for most efficient photographing. Also, the slots on the board of the fluorimeter would be labeled to avoid confusion in the process of analysis. | ||
Line 154: | Line 151: | ||
''Fluorimeter: We chose to include these new features'' | ''Fluorimeter: We chose to include these new features'' | ||
* Integrated Camera - helps reduce inconsistency of photography and time-consuming difficulty of positioning | * Integrated Camera - helps reduce inconsistency of photography and time-consuming difficulty of positioning | ||
* Labeled slots - reduces likelihood of error from misidentified photographs | * Labeled slots - reduces likelihood of error from misidentified photographs <br> | ||
<!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above--> | <!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above--> | ||
Line 171: | Line 168: | ||
*Step 4: Take photo.<br> | *Step 4: Take photo.<br> | ||
*Step 5: Upload photo for necessary manipulation. <br> | *Step 5: Upload photo for necessary manipulation. <br> | ||
<br><br> | <br><br> | ||
Revision as of 02:41, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. - Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. We concluded that we would Want a good system to have: - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. - integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter: We chose to include these new features
PCR Machine: We chose keep the devices the same as the original system
New System: ProtocolsDESIGN
MATERIALS
New System: Research and DevelopmentBACKGROUND
DESIGN
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|