Difference between revisions of "BME103 s2013:T900 Group4 L3"
Anna Essex (talk | contribs) (→New System: Software) |
(→New System: Design Strategy) |
||
(23 intermediate revisions by 2 users not shown) | |||
Line 15: | Line 15: | ||
| [[Image:Smile_Group4.jpg|120px|thumb|Name: Kinjal Ahir Role:Protocol]] | | [[Image:Smile_Group4.jpg|120px|thumb|Name: Kinjal Ahir Role:Protocol]] | ||
| [[Image:133834815227.jpg|120px|thumb|Name: Zach Young <br>Initial Machine Testing]] | | [[Image:133834815227.jpg|120px|thumb|Name: Zach Young <br>Initial Machine Testing]] | ||
− | | [[Image: | + | | [[Image:OregonLove.jpg|120px|thumb|Name: Anna Essex <br>Initial Machine Testing]] |
| [[Image:Smile_Group4.jpg|120px|thumb|Name: Tuan Phan <br>Research and Design]] | | [[Image:Smile_Group4.jpg|120px|thumb|Name: Tuan Phan <br>Research and Design]] | ||
| [[Image:BME103_Group4Vergil_ODST.jpg|120px|thumb|Name: Amelia Lax <br>Research and Design]] | | [[Image:BME103_Group4Vergil_ODST.jpg|120px|thumb|Name: Amelia Lax <br>Research and Design]] | ||
Line 28: | Line 28: | ||
{| {{table}} | {| {{table}} | ||
|- | |- | ||
− | | Sample Name || Ave. INTDEN* || Calculated (μg/mL) || Conclusion (pos/neg) | + | | '''Sample Name''' || '''Ave. INTDEN*''' || '''Calculated (μg/mL)''' || '''Conclusion (pos/neg)''' |
|- | |- | ||
| Positive Control || 1,450,385 || 1.60 || pos | | Positive Control || 1,450,385 || 1.60 || pos | ||
Line 52: | Line 52: | ||
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | ||
<br> | <br> | ||
− | Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) | + | ''Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)'' |
− | Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> | + | '''Calculation 1:''' The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> |
* A = frequency of cancer-positive conclusions = 9 / 20 = 0.45 | * A = frequency of cancer-positive conclusions = 9 / 20 = 0.45 | ||
* B = frequency of positive PCR reactions = 26 / 60 = 0.43 | * B = frequency of positive PCR reactions = 26 / 60 = 0.43 | ||
Line 62: | Line 62: | ||
<br> | <br> | ||
− | + | '''Calculation 2:''' The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | |
− | Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | ||
* A = frequency of cancer-negative conclusions = 11 / 20 = 0.55 | * A = frequency of cancer-negative conclusions = 11 / 20 = 0.55 | ||
* B = frequency of negative PCR reactions = 34 / 60 = 0.57 | * B = frequency of negative PCR reactions = 34 / 60 = 0.57 | ||
Line 70: | Line 69: | ||
<br> | <br> | ||
− | Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.<br> | + | '''Calculation 3:''' The probability that the patient will develop cancer, given a cancer DNA sequence.<br> |
* A = frequency of "yes" cancer diagnosis = 9 / 20 = 0.45 | * A = frequency of "yes" cancer diagnosis = 9 / 20 = 0.45 | ||
* B = frequency of "pos" test conclusion = 26 / 60 = 0.43 | * B = frequency of "pos" test conclusion = 26 / 60 = 0.43 | ||
Line 77: | Line 76: | ||
<br> | <br> | ||
− | + | '''Calculation 4:''' The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | |
− | Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | ||
* A = frequency of "no" cancer diagnosis = 11 / 20 = 0.55 | * A = frequency of "no" cancer diagnosis = 11 / 20 = 0.55 | ||
* B = frequency of "neg" test conclusion = 34 / 60 = 0.57 | * B = frequency of "neg" test conclusion = 34 / 60 = 0.57 | ||
Line 92: | Line 90: | ||
* [Must have #2 - why? short, ~4 or 5 sentences]--> | * [Must have #2 - why? short, ~4 or 5 sentences]--> | ||
− | + | * Easily Determined Results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. | |
− | + | * Simple Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. | |
+ | |||
'''We concluded that we would ''Want'' a good system to have:''' | '''We concluded that we would ''Want'' a good system to have:''' | ||
Line 100: | Line 99: | ||
* [Want #2 - why? short, ~4 or 5 sentences]--> | * [Want #2 - why? short, ~4 or 5 sentences]--> | ||
− | + | * Low Cost: Currently an OpenPCR machine costs $599 and a fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. | |
− | + | * Integrated Camera: Phone cameras are easily moveable and vary in size and quality, leading to differing results. Adjusting smartphone camera settings can be time consuming or, in some models, impossible. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. This also simplifies the software is because the PCR does not have to adjust to different cameras. Finally, phone sizes and shapes vary enough to make building a universal cradle to fit them difficult. | |
Line 109: | Line 108: | ||
* [Must Not Have #2 - why? short, ~4 or 5 sentences]--> | * [Must Not Have #2 - why? short, ~4 or 5 sentences]--> | ||
− | + | * Unpredictable USB Connectivity: USB connectivity should function well and consistently in order for the PCR machine to work. This also reduces troubleshooting time and is a fairly simple problem to fix in a new system's design. | |
− | |||
− | |||
− | |||
− | |||
+ | * Flammable Casing: The PCR rapidly cycles through different temperatures, some extremely high. As with other electronics, the wires and other electrical components could overheat or spark. At the very least, the wooden casing currently used could damage the machine beyond repair, and at worst, lead to massive fires in areas with expensive equipment and many people. Simply changing the casing to a material like plexiglass would solve this problem. | ||
Line 121: | Line 117: | ||
* [Should Avoid #2 - why? short, ~4 or 5 sentences]--> | * [Should Avoid #2 - why? short, ~4 or 5 sentences]--> | ||
− | + | * Slow Amplification: Increasing the speed of diagnosis would make the test more efficient and possibly allow for a verdict while the patient is still in the doctor's office without spending an inordinate amount of time. However, speed will be sacrificed if need be to accommodate more important features such as accuracy. | |
− | |||
− | |||
− | |||
− | |||
− | |||
+ | * Movable Phone or Fluorimeter: In the current system, which uses a smartphone in a cradle instead of a built-in camera, the phone or fluorimeter can be easily moved by accident, which requires readjustment and can possibly skew results. Using the current setup decreases accuracy but also decreases cost. We placed accuracy as more important than cost, but the opportunity to reduce price if the machine is too costly keeps this idea from being completely rejected. | ||
<br><br> | <br><br> | ||
Line 189: | Line 181: | ||
<br> | <br> | ||
'''MATERIALS''' | '''MATERIALS''' | ||
− | {| {{table}} width=700 | + | ::{| {{table}} width=700 |
|- | |- | ||
| '''Supplied in the Kit''' || '''Amount''' | | '''Supplied in the Kit''' || '''Amount''' | ||
Line 202: | Line 194: | ||
|} | |} | ||
− | {| {{table}} width=700 | + | ::{| {{table}} width=700 |
|- | |- | ||
| '''Supplied by the User''' || '''Amount''' | | '''Supplied by the User''' || '''Amount''' | ||
Line 267: | Line 259: | ||
==New System: Research and Development== | ==New System: Research and Development== | ||
− | '''BACKGROUND''' | + | '''BACKGROUND'''<br> |
− | |||
<!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | <!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | ||
− | + | CHEK2 is a gene located at chromosome 22. It provides instructions for making protein called checkpoint kinase 2, a tumor suppressor. This particular protein responds to damage in DNA, preventing the cell from entering mitosis when the cell's DNA deviates from normal. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases. The mutation targeted by our primers is a single base change from adenine to cytosine at position 29121087, the cytosine variant being cancerous. | |
− | CHEK2 is a gene located at chromosome 22. It provides instructions for making protein | + | <br><br> |
− | + | '''DESIGN'''<br> | |
− | '''DESIGN''' | + | In our design, we chose to use primers for both normal and cancer-associated DNA sequences so users can cross-check their results. For example, if a patient's test returns positive for the cancer-associated allele, the test can be run with a normal allele primer to ensure that the test results were accurate, in which case the test for the normal allele should be negative. This addition of primers associated with the normal sequence allows users to test for the presence of normal DNA if they suspect that the cancer-associated DNA is not present. This helps fulfill our goal of making a more reliable test. It takes more time to run more samples, but it provides an extra layer of caution to help ensure correct diagnosis. |
− | + | <br><br> | |
− | |||
'''Primers for PCR'''<br> | '''Primers for PCR'''<br> | ||
<!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | <!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | ||
+ | Normal Allele<br> | ||
+ | Forward Primer: TATGTATGCAATGTAAGAGTT<br> | ||
+ | Reverse Primer: TGAACCACTGGTGAAAAGAAC<br> | ||
− | + | Cancerous Allele<br> | |
− | + | Forward Primer: ATACATACGTGACATTCTCAA<br> | |
+ | Reverse Primer: TGAACCACTGGTGAAAAGAAC | ||
+ | <br><br> | ||
<!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | <!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | ||
− | + | '''Our primers address the following design needs'''<br> | |
− | '''Our primers address the following design needs''' | + | * Easily Determined Results: As we considered diagnostic accuracy absolutely essential to a new system, the inclusion of a normal forward and reverse primer acts as a second layer of security and a way users can double-check results. This makes the system slightly more expensive and take more time, but both of those aspects were considered adjustable rather than absolute. |
− | * | ||
− | |||
− | |||
Line 293: | Line 285: | ||
==New System: Software== | ==New System: Software== | ||
− | As has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye. As ImageJ is a Java-based program, converting it to an Android app would be fairly straightforward. Similarly, channeling a phone to control an external camera is nothing particularly revolutionary but would greatly increase the efficiency and accuracy of this lab. Open PCR software could also be streamlined to run more quickly and give more accurate readouts during runtime. In reality, software modifications would provide the most improvement for this lab with relatively little effort. | + | As has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye. <br> |
+ | <br> | ||
+ | As ImageJ is a Java-based program, converting it to an Android app would be fairly straightforward. Similarly, channeling a phone to control an external camera is nothing particularly revolutionary but would greatly increase the efficiency and accuracy of this lab. Open PCR software could also be streamlined to run more quickly and give more accurate readouts during runtime. In reality, software modifications would provide the most improvement for this lab with relatively little effort. | ||
Latest revision as of 08:13, 16 April 2013
![]() |
Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ContentsOUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have:
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter - We chose to include these new features:
PCR Machine - We chose keep these features the same as the original system:
New System: ProtocolsDESIGN
New System: Research and DevelopmentBACKGROUND Cancerous Allele
New System: SoftwareAs has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye.
|