BME103:W930 Group9

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Tyler Ray Research and development scientist Name: Seth Howell Protocol Name: Ryan Open PCR machine engineer Name: Hamas Protocol Name: Deanna Open PCR machine engineer Name: Daniela Data Compiler and Analyzer LAB 1 WRITE-UP Initial Machine Testing The Original Design The open PCR is a device that enables the splitting of DNA. It is run through many cycles of heating and cooling that enables the splitting and recombination with polomers. It connects to a computer program to run the cycles. The temperature change is controled by the heating lid and than the information is fed to the LED screen. The heating lid heats tubes that are held in the heat tube holder to the appropriate temperature and then cools them as needed in each cycle. Experimenting With the Connections When we unplugged part 3, the LCD, from part 6, the Open PCR Brains Board, the LCD on the machine stopped working and did not show anything on it. When we unplugged the white wire that connects part 6, the Open PCR Brains Board, to part 2, the heat tube, the machine no longer measures the temperature of the plate and sends it to the LCD. Test Run First test run: 24 Oct. 2012 Experiences with it: It worked very well with minimal problems. The program would not allow us to enter the parameters once they were set. Aside form that, everything functioned with ease. Protocols Polymerase Chain Reaction Polymerase Chain Reaction uses thermal cycling to artificially replicate DNA in vitro. First, a piece of double stranded DNA is added to a test tube containing a solution of primers, and the enzyme DNA polymerase. This solution is heated to 95 degrees celsius in order to separate (denature) the DNA molecule. Then, the solution is cooled to 57 degrees celsius and the primers bind to the single strands of DNA (provided the base sequences match up), then the solution is heated to 72 degrees celsius and DNA polymerase adds bases to complete the new complimentary strands, doubling the amount of DNA. This is repeated several times. Procedure for amplifying a person’s DNA 1. Add .2ng’s of a person’s dna to a tube containing the proper primers, water, and the GoTaq master mix. Repeat this step for as many replicates as you need. 2. Create a program on the open PCR machine that will run the proper cycle for replicating DNA. 3. The proper program will include an initial temperature hold of 95 degrees Celsius for three minutes, followed by 35 cycles of 95 to 57 to 72 all for 30 seconds each, then a final hold for 3 minutes at 72 degrees. 4. Place the tubes in the open pcr machine making sure to close the lid. 5. Run the program with the tubes inside the machine. The Master Mix GoTaq colorless Master Mix was used in this experiment. It contains taq polymerase, dNTPs(bases), MgCl2, and reaction buffers. Specifically, 2x colorless GoTaq master mix contains 400um of each base, and 3mm MgCl2 and a reaction buffer of pH 8.5. Part of this was then mixed with a few other ingredients as detailed in the table below. (information from www.promega.com) Contents of PCR vials Reagent Table Volume Template DNA (20 ng) .2 μL 10 μM forward primer 1.0 μL 10 μM reverse primer 1.0 μL GoTaq master mix 50.0 μL dH2O 47.8 μL Total Volume 100.0 μL The Samples The eight samples run in our pcr experiment were a positive control, a negative control, and three replicate samples from each of our patients. Patients Patient ID Gender Age 27150 Female 61 73439 Male 62 Flourimeter Measurements Fluorimeter setup Flourimeter procedure 1. Place the flourimeter on the table and turn on the blue light. 2. Place provided glass slide on flourimeter track so that the first row of dots is even with the light. 3. Place phone cradle in front of the flourimeter with a smart phone facing perpendicular to the beam of light. (as seen in the picture). 4. Add two drops of green dye on the dots that are even with the light. 5. Place two drops of DNA sample on top of the green dye. 6. Cover the flourimeter and phone by turning the large box over and placing it above both of them. 7. Take a picture of the droplet with the camera. 8. Save the picture and send it to the imageJ operator. Instructions for opening images in imageJ 1. Take a picture of the fluorimeter assembly with a smartphone. 2. Transfer the picture to a laptop equipped with imageJ via icloud or email. 3. Open imageJ and select file, then open. 4. Find the file on the computer and select it. 5. The image is now open and can be analyzed. 6. The image can be split into three images (blue, green, and red) for better analysis by selecting: image-color-split channels. Research and Development Specific Cancer Marker Detection - The Underlying Technology DNA strands across human beings are very similar, but there is a correlation between the discrepancies between DNA sequences and phenotypic conditions such as cancer or heart disease. Because DNA is so small, and has so many components, it is not reasonable to simply look through the entire strand for the sequence of interest. This report used a technique that amplified specific DNA strands which is called Polymerase Chain Reaction or PCR. This technique uses a primer that identifies and replicates a specific gene sequence, if that sequence is present. To explain how this method is used, we will consider the sequence, rs17879961. This specific sequence is found on chromosome 22 and is associated with colorectal and breast cancer. Normal GTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC Cancer GTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control 815872 0 neg PCR: Positive Control 2469599 2 pos PCR: Patient 1 ID 27150, rep 1 868816 .704 neg PCR: Patient 1 ID 27150, rep 2 1296676 1.05 pos(borderline) PCR: Patient 1 ID 27150, rep 3 701619 .568 neg PCR: Patient 2 ID 73439, rep 1 2296110 1.860 pos PCR: Patient 2 ID 73439, rep 2 1296676 1.822 pos PCR: Patient 2 ID 73439, rep 3 2795519 2.264 pos KEY Sample = A sample was two drops of a flourescent dye that stains DNA green and two drops of DNA solution, either provided as a control, or obtained from open pcr. Integrated Density = Integrated density basically measures the amount of brightness there is in a certain area. This is an extensive property (one that depends on how many pixels were in the system) so areas as close in size to each other were used as measurements. The integrated density shown in the tablewas determined by the following means. The integrated density of an area immediately above the droplet was subtracted from the integrated density of the area covering the droplet. DNA μg/mL = This value was calculated by dividing the integrated density of the sample by the integrated density of the positive control and multiplying that number by 2 μg/mL (the amount of DNA in the positive control). Conclusion = Samples were considered positive for the gene if they contained more than 1 μg/mL of DNA. Samples within .1 μg/mL were arbitrarily determined to be borderline, or tentatively positive.