BME103:W930 Group7 l2: Difference between revisions
Seong Song (talk | contribs) |
Seong Song (talk | contribs) |
||
Line 181: | Line 181: | ||
Anencephaly : | Anencephaly : | ||
Alleles: [C/T] | |||
Forward Primer: | Forward Primer: | ||
TAATATGTAATTTTATTTTCATTTTAGCTG | TAATATGTAATTTTATTTTCATTTTAGCTG |
Revision as of 23:23, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.
Key Features Uh... doesn't cost more money? No new assembly instructions?
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAT5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Anencephaly : Alleles: [C/T] Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
|