Difference between revisions of "BME103:W930 Group7 l2"

From OpenWetWare
Jump to: navigation, search
(Thermal Cycler Engineering)
(Research and Development)
Line 167: Line 167:
Forward Primer:
Reverse Primer:
Line 185: Line 179:
The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.  
The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.  
Anencephaly :
Forward Primer:
Reverse Primer:

Revision as of 21:38, 27 November 2012

Owwnotebook icon.png BME 103 Fall 2012 Home
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Wiki Editing Help
BME494 Asu logo.png


Name: Jake Turner
PCR Machine Engineer
Name: Tyler Allen
PCR Machine Engineer, Graphic Designer
Name: Khalil Pathan
Experimental Protocol Planner
Name: Pahul Singh
Experimental Protocol Planner
Name: Frea Mehta
Research and Development Specialist
Name: Paul Song
Research and Development Specialist


Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

Open PCR Machine

System Design

While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, user friendly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.

Heating Block Improvements

Device Housing Improvements

Latch Design Improvements

Key Features




Supplied in the Kit Amount
Open PCR 1
USB Cable 1
Standardized Mat with Measurements 1
Fluorimeter 1
Phone Holder 1
Light Box 1
Hydrophobic Glass slides 3
Positive Control DNA 5 mL
SYBR Gene Dye 5 mL

Supplied by User Amount
Micropipettes 1
Micropipette tips 200
Lab Coats 2
Template DNA 3.2 μL
Smart Phone(with camera) 1

PCR Protocol

DNA Measurement Protocol

Research and Development

An anencephalactic fetus

Background on Disease Markers

The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]

Anencephaly is a relatively common neural tube defect that occurs during early fetal development; it causes parts of the brain and skull to not develop and results in fetal mortality in almost all cases. Although most occurrences of anencephaly are attributed to environmental toxins or low folic acid intake during pregnancy [2], but has also been affiliated with Meckel syndrome, a rare genetic disorder that affects the RPGRIP1L gene [3]. The most severe phenotypes of Meckel syndrome are present with complete inactivation of the RPGRIP1L gene.

The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is


Primer Design

Alzheimer- Alleles: [A/C]



The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.


