BME103:W930 Group4: Difference between revisions
No edit summary |
|||
(31 intermediate revisions by 5 users not shown) | |||
Line 14: | Line 14: | ||
|- valign="top" | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Renaad Alawi<br>Experiemental Protocol Planner]] | | [[Image:BME103student.jpg|100px|thumb|Name: Renaad Alawi<br>Experiemental Protocol Planner]] | ||
| [[Image: | | [[Image:Lauren_Allison.jpg|100px|thumb|Name: Lauren Allison<br>Research and Development]] | ||
| [[Image: | | [[Image:Jake_Krammer.jpg|100px|thumb|Name: Jake Krammer<br>Open PCR Machine]] | ||
| [[Image: | | [[Image:Jan_Simper.jpg|100px|thumb|Name: Jan Simper<br>Open PCR Machine]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Justus Vangor<br>Research and Development]] | | [[Image:BME103student.jpg|100px|thumb|Name: Justus Vangor<br>Research and Development]] | ||
| [[Image:Christian_Vargas.jpg|100px|thumb|Name: Christian Vargas<br>Experimental Protocol Planner]] | | [[Image:Christian_Vargas.jpg|100px|thumb|Name: Christian Vargas<br>Experimental Protocol Planner]] | ||
Line 28: | Line 28: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
[[Image: | [[Image:OpenPCR_machine.png]] | ||
The Polymerase Chain Reaction(PCR) machine essentially tests sequences of DNA for variations in nucleotides. This simple device is portable, easy to use, and relatively inexpensive. | The Polymerase Chain Reaction(PCR) machine essentially tests sequences of DNA for variations in nucleotides. This simple device is portable, easy to use, and relatively inexpensive. The LCD screen provides information on what step of the reaction is currently taking place. The heating lid heats up the samples contained within the sample holder, allowing the reaction to occur. The circuit board allows the fan, the heater, and the LCD screen to all run efficiently by connecting their wires to a central area. The PCR Machine is able to test up to 16 samples of DNA at a time and can be connected to a computer for ease of use. The machine heats up DNA samples so the samples disassociate allowing a primer to connect to the sequences of DNA and then the machine cools the DNA samples down with the primer in place. | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
Line 39: | Line 39: | ||
'''Test Run''' | '''Test Run''' | ||
The date OpenPCR was first tested was October 24, 2012. The test tubes were put into the machine and the handle was secured over them. There was a little difficulty in determining when to stop turning the handle. The software itself was simple and easy to use and there were no problems in running the OpenPCR software. After the reaction was complete, the tubes were taken out, labeled, and stored in a refrigerated area. <br> | The date the OpenPCR Machine #4 was first tested was October 24, 2012. The test tubes were put into the machine and the handle was secured over them. There was a little difficulty in determining when to stop turning the handle. The software itself was simple and easy to use and there were no problems in running the OpenPCR software. After the reaction was complete, the tubes were taken out, labeled, and stored in a refrigerated area. <br> | ||
Line 50: | Line 50: | ||
The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.<br> | The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.<br> | ||
<br> Thermal Cycling Process <br> | <br> ''Thermal Cycling Process:'' <br> | ||
1)The DNA is first heated to 95 degrees Celsius which will in turn unzip the DNA to expose its bases and create two one-stranded strips | 1)The DNA is first heated to 95 degrees Celsius which will in turn unzip the DNA to expose its bases and create two one-stranded strips <br> | ||
2)After primer is added to the solution, the DNA is then cooled down to 57 degrees Celsius so that the said primer can attach to a template sequence to form a forward primer.<br> | 2)After primer is added to the solution, the DNA is then cooled down to 57 degrees Celsius so that the said primer can attach to a template sequence to form a forward primer.<br> | ||
3)The DNA is then once more heated to 72 degrees Celsius so that the replication process can be completed.<br> | 3)The DNA is then once more heated to 72 degrees Celsius so that the replication process can be completed.<br> | ||
4)This process is repeated 30 more times to acquire a greater number of DNA samples.<br> | 4)This process is repeated 30 more times to acquire a greater number of DNA samples.<br> | ||
<br>PCR Master Mix Components:<br> | <br>''PCR Master Mix Components:''<br> | ||
-GoTaq® Colorless Master Mix, 2X 25μl <br> | -GoTaq® Colorless Master Mix, 2X 25μl <br> | ||
-upstream primer 10μM <br> | -upstream primer 10μM <br> | ||
Line 61: | Line 61: | ||
-DNA template 1–5μl <br> | -DNA template 1–5μl <br> | ||
-Nuclease-Free Water to 50μl <br> | -Nuclease-Free Water to 50μl <br> | ||
{| {{table}} | |||
|- style="background:#f0f0f0;" | |||
| '''Reagent''' || '''Volume''' || | |||
|- | |||
| Template DNA (20 ng) || 0.2 µL || | |||
|- | |||
| 10 µM Forward Primer || 1.0 µL || | |||
|- | |||
| 10 µM Reverse Primer || 1.0 µL || | |||
|- | |||
| GoTaq Master Mix || 50.0 µL || | |||
|- | |||
| dH2O || 47.8 µL || | |||
|- | |||
| Total Volume || 100.0 µL || | |||
|- | |||
|} | |||
<br>''Patient Sample Descriptions:''<br> | |||
Positive Control: Cancer DNA Template<br> | |||
Negative Control: DNA Template<br> | |||
Patient 1, Replicates(1,2,3):<br> | |||
ID: 80175<br> | |||
Gender: Female<br> | |||
Age: 59<br> | |||
Patient 2, Replicates(1,2,3):<br> | |||
ID: 57483<br> | |||
Gender: Male<br> | |||
Age: 56<br> | |||
'''Fluorimeter Measurements'''<br> | '''Fluorimeter Measurements'''<br> | ||
<br>''Fluorimeter Assembly Set-Up''<br> | |||
[[Image:Fluorimeter Set up.jpg]] | |||
<br>''Fluorimeter Assembly Procedeure:''<br> | |||
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br> | |||
2)label each pipette so that you don't use the same one for each sample.<br> | |||
3)Place the glass slide with th drops on the device.<br> | |||
4)Turn on the blue LED light.<br> | |||
5)Place the smartphone on the holder provided and position them in front of the device.<br> | |||
6)Place a box on top of the device and smartphone to create a dark environment.<br> | |||
7)Take a close clear picture of the drop.<br> | |||
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the devicelso make sure the phone is at the same position each time.<br> | |||
<br> ''Opening Images in Image J:'' <br> | |||
1)Using the android phone, email the pictures taken from the phone to the email of the ImageJ Software Operator.<br> | |||
2)Open the email of the ImageJ Operator and save the pictures onto the computer of the ImageJ Software Operator.<br> | |||
3)Open up the ImageJ Software.<br> | |||
4)Click File > Open. <br> | |||
5)Then select the images from wherever they were saved on the computer.<br> | |||
6)Click open and the image should appear in the program.<br> | |||
Line 104: | Line 153: | ||
• Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place. | • Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place. | ||
Specific to this cancer gene: | |||
The reverse primer that should bond to the cancer gene is AACTCTTACACTGCATACAT. | |||
The forward primer that should bond to the cancer gene is GTATAAGACATTCCTGTCCT (200 bp away from reverse) | |||
Line 109: | Line 163: | ||
In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients. | In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients. | ||
Specific to this cancer gene: | |||
Approximately 1.1% of people have the C/T variation | |||
p (hc|C) = p(C|hc) p(hc) / p(C) | |||
where p(C)=5% and p(hc|C)=7.8% | |||
<br> | <br> | ||
Line 134: | Line 196: | ||
| PCR: Positive Control || 26759481 || 2 || Positive for gene | | PCR: Positive Control || 26759481 || 2 || Positive for gene | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 80175, rep 1 || 17085185 || 1.27694 || Positive for gene | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 80175, rep 2 || 12388707 || 0.92593 || Positive for gene | ||
|- | |- | ||
| PCR: Patient 1 ID | | PCR: Patient 1 ID 80175, rep 3 || 4620549 || 0.345339 || Negative for gene | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 57483, rep 1 || 16031260 || 1.19817 || Positive for gene | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 57483, rep 2 || 11636055 || 0.869677 || Positive for gene | ||
|- | |- | ||
| PCR: Patient 2 ID | | PCR: Patient 2 ID 57483, rep 3 || 18928511 || 1.41471 || Positive for gene | ||
|} | |} | ||
Line 152: | Line 214: | ||
* '''Integrated Density''' = Integrated density is an extensive quantity. It is the sum of the values of the pixels in the image or selection equivalent to the product of the area and mean gray value. We subtracted the integrated density of the background from the integrated density of our sample to obtain our data. | * '''Integrated Density''' = Integrated density is an extensive quantity. It is the sum of the values of the pixels in the image or selection equivalent to the product of the area and mean gray value. We subtracted the integrated density of the background from the integrated density of our sample to obtain our data. | ||
* '''DNA μg/mL''' = The concentration was obtained by dividing the integrated density of the sample with the background subtracted by the integrated density of the positive control with the background subtracted and multiplying by 2. | * '''DNA μg/mL''' = The concentration was obtained by dividing the integrated density of the sample with the background subtracted by the integrated density of the positive control with the background subtracted and multiplying by 2. | ||
* '''Conclusion''' = | * '''Conclusion''' = Whether or not the sample was positive for the cancer gene. | ||
Latest revision as of 14:23, 30 May 2013
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine TestingThe Original Design Experimenting With the Connections When the mounting plate was unplugged from the circuit board, the machine the LCD light and the menu on the PCR machine shut off. When the white wire that connects the circuit board to the sample holder was unplugged, the temperature on the menu on the PCR machine dropped from room temperature to -40.0 degrees Celsius. The conclusion is that the white wire was the temperature sensor wire.
ProtocolsPolymerase Chain Reaction The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology What is the function of each component of a PCR reaction? Template DNA: A double-stranded segment of DNA that encodes either a cancerous gene or a normal gene Primers: Short segments of DNA that bind to a specific sequence of nucleotides (binds to cancer gene) Taq Polymerase: A protein that serves as the catalyst for the DNA replication; grabs extra nucleotides within the solution and binds them to the "unzipped" strands Magnesium Chloride: A cofactor that binds to the Taq Polymerase and affects the speed of the reaction; positive correlation between amount of magnesium chloride and reaction speed dNTP's: Deoxynucleotide triphosphates; extra nucleotide bases in solution that are able to be grabbed and synthesized by Taq Polymerase to replicate DNA strands beyond the primer sequence
• At 95° Celsius: DNA melts and "unzips" to create two one-stranded strips, primers are added to the solution • At 57°Celsius: Primers attach to the corresponding template sequence they complement, forming one forward primer and one reverse primer • At 72° Celsius: Taq Polymerase finishes the replication process with the use of dNTP's and magnesium chloride
Why does a cancer gene produce a positive result while a normal gene produces a negative? • Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place. Specific to this cancer gene: The reverse primer that should bond to the cancer gene is AACTCTTACACTGCATACAT. The forward primer that should bond to the cancer gene is GTATAAGACATTCCTGTCCT (200 bp away from reverse)
In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients. Specific to this cancer gene: Approximately 1.1% of people have the C/T variation p (hc|C) = p(C|hc) p(hc) / p(C) where p(C)=5% and p(hc|C)=7.8%
Image Credit to OpenPCR.org/use-it/
Results
|