BME103:W930 Group3 l2: Difference between revisions
(3 intermediate revisions by one other user not shown) | |||
Line 38: | Line 38: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original design | The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original structural design wood was the main material of the Open PCR's lid. This redesign changes the material used on the sides of the lid from wood to plexi-glass. The use of plexi-glass allows for the user to see into the lid of the Open PCR machine.This change allows the user to view the height of the heat plate while adjusting it, therefore minimizing the the chance of the user crushing the DNA samples while lowering the heat plate. The other modification present in the redesign was that the magnetic clasp from the original design was replace by spring catch. The original magnetic clasp on the PCR required too much force to open. While this magnet prevented the lid to open mistakenly during an experiment, it made the machine vulnerable to breakage when the lid needed to be opened. The newly added catch provides the same amount of protection in terms of mistaken lid opening but it also increases ease of use and limits the chance of breakage while opening the lid. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same | Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same measurements of the preexisting wood piece. This means that the only modification to the instructions should be an updated description of the piece to look for when installing this part. The second changes made to the building instructions will need to describe and depict the attachment of the new "spring clasp" to the lid. The new clasp will consist of two parts--a mortise type receiver, and a tenon. The tenon should be directed to be screwed onto the lid, facing down. The mortise type receiver should be screwed down and attached to the top of the PCR machine that the lid is also attached to. This piece should be corresponding to the tenon component to ensure both pieces fit together during the closing of the lid. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 286: | Line 286: | ||
Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for | Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for Alzheimer's disease. | ||
==Research and Development== | ==Research and Development== | ||
Line 303: | Line 303: | ||
Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br> | Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br> | ||
Forward Primer: TAGCCTATTTATTTTCTTCA<br> | Forward Primer: TAGCCTATTTATTTTCTTCA<br> | ||
The diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation. | The target diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation. | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Latest revision as of 10:17, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Our TeamLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials List of Required Materials for PCR & DNA measurements
Contents of each DNA solution
PCR Protocol Step 1) Download the Open PCR software.
Substep A) Click on the “more options” button. Substep B) Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time. Substep C) In the box labeled Number of Cycles, input 30. Substep D) Set the denaturing temperature and time to 95°C and 30 seconds. (The two boxes in the first row) Substep E) Set the annealing temperature and time to 57°C and 30 seconds. (The two boxes in the second row) Substep F) Set the extending temperature and time to 72°C and 30 seconds. (The two boxes in the third row) Substep G) Add a final step. Set the temperature and time to 72°C and 180 seconds. Substep H) Set the final hold temperature to 4°C.
DNA Measurement Protocol
Substep A) Disable camera flash. Substep B) Set the ISO to 800 or higher. Substep C) Set the white balance to auto. Substep D) Maximize the exposure setting. Substep E) Maximize the saturation setting. Substep F) Minimize the contrast setting. Note that not all smartphone cameras will have these settings, just disable flash if not all these options are available.
Step 13) Take a picture of the fluorimeter and the SYBR green dye drop, recording the image number and DNA sample.
Research and DevelopmentBackground on Disease Markers
|