BME103:W930 Group1 l2: Difference between revisions
Kevin M. Chu (talk | contribs) |
|||
(17 intermediate revisions by 5 users not shown) | |||
Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:K_Chu.jpg|100px|thumb|Name: Kevin Chu<br>Experimemtal Protocol Planner]] | | [[Image:K_Chu.jpg|100px|thumb|Name: Kevin Chu<br>Experimemtal Protocol Planner]] | ||
| [[Image: | | [[Image:Rodin_Thinker.JPG|100px|thumb|Name: Zhiyue Yang<br>Open PCR Machine Engineer]] | ||
| [[Image:MyPicture.jpg|100px|thumb|Name: Vanessa Barker<br> Open PCR Machine Engineer]] | | [[Image:MyPicture.jpg|100px|thumb|Name: Vanessa Barker<br> Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:Acces_Pompiers.JPG|100px|thumb|Name: Michael Dennison<br>Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:Stair_Architecture.JPG|100px|thumb|Name:Bri Ackerman<br>R&D Scientist]] | ||
| [[Image: | | [[Image:Eiffel_Night.jpg|100px|thumb|Name: Ben Duguay<br>R&D Scientist]] | ||
| [[Image: | | [[Image:Tiger_Japan.jpg|100px|thumb|Name: Haley Parrott<br>Role(s)]] | ||
|} | |} | ||
Line 32: | Line 32: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:PCRLid.png|800x400px|]]<br> | [[Image:PCRLid.png|800x400px|]]<br> | ||
The picture shown above is the top of an Open PCR machine. This part consists of a LCD screen and a heating lid. The top of the machine has several issues. For example, the lid is hard to open. To solve these issues, we came up with | The picture shown above is the original top of an Open PCR machine. This part consists of a LCD screen and a heating lid. The top of the machine has several issues. For example, the lid is hard to open before the redesign. To solve these issues, we came up with several possible changes.<br> | ||
[[Image:NewPCR.jpg|600px]]<br> | |||
This picture show the redesigned Open PCR Machine complete with the modifications detailed below. | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can remove the knob which adjusts lid height. This knob ultimately makes the machine more confusing, as it is difficult to tell whether the lid is too high - causing the samples to receive less heat - too low - squishing the samples and potentially warping or damaging the test tubes the samples are in - or at the proper height. Instead, the lid will remain at the same height as long as the machine is closed and a specific test tube size will be standardized for the machine. | Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can remove the knob which adjusts the heating lid height. This knob ultimately makes the machine more confusing, as it is difficult to tell whether the lid is too high - causing the samples to receive less heat - too low - squishing the samples and potentially warping or damaging the test tubes the samples are in - or at the proper height. Instead, the lid will remain at the same height as long as the machine is closed and a specific test tube size will be standardized for the machine. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The following changes to the previous assembly instructions will be made based on the above design modifications:<br> | |||
#Where the original instructions explained the assembly of the latch on the lid, the original latch pieces will be replaced with the magnetic latch pieces. These parts will be installed in the same position and manner as the former latch, but will be two magnetic pieces rather than a latch that hooks together.<br> | |||
#Rather than screwing the wooden boards together to form the outside case, the consumer will need only hook the inside pieces within the already-assembled plastic case (all one piece, excluding the lid and one removable panel) using the following instructions:<br> | |||
#*Assemble inner parts and attach within case as explained in original instructions. | |||
#*Snap removable panel into place on the front (open) side of the case. | |||
#*Use provided screws to attach the lid hinge to the lid. Screw lid hinge into the top of the main case; lid should cover the sample plate. | |||
#The original instructions on attaching the lid-adjusting knob will be removed. In their place will be a disclaimer providing information on the appropriate test tube size for the machine and where these test tubes are available for purchase. | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 176: | Line 184: | ||
#Turn on the fluorimeter so that a blue light shines. | #Turn on the fluorimeter so that a blue light shines. | ||
#From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on<br> a glass slide. The two drops should combine to form a single larger drop. | #From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on<br> a glass slide. The two drops should combine to form a single larger drop. | ||
#Adjust the slide so that the blue light shines through the drops. | |||
#Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | #Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | ||
#On the Smartphone, adjust the following settings | #On the Smartphone, adjust the following settings | ||
Line 190: | Line 199: | ||
#In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value. | #In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value. | ||
#Select Image > Color > Split Channels. Three images will appear; choose the one named green. | #Select Image > Color > Split Channels. Three images will appear; choose the one named green. | ||
# | #Select the oval tool and draw an oval around the drop. Then, go to analyze and measure, and record the measurements. | ||
#Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | #Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | ||
#Repeat steps 16-20 for all of the pictures. Make sure each sample lines up with the correct INTDEN measurements. | #Repeat steps 16-20 for all of the pictures. Make sure each sample lines up with the correct INTDEN measurements. | ||
Line 218: | Line 227: | ||
The sequence for the heterotaxy disease allele is '''CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT''', with the mutation occurring at the '''[A/G]''' site. When the '''A''' gene is expressed, the mutation occurs and heterotaxy is coded. When the '''G''' gene is expressed, there is no mutation and the gene expression is normal. | The sequence for the heterotaxy disease allele is '''CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT''', with the mutation occurring at the '''[A/G]''' site. When the '''A''' gene is expressed, the mutation occurs and heterotaxy is coded. When the '''G''' gene is expressed, there is no mutation and the gene expression is normal. | ||
Forward primer sequence (position 136,651,203 – 136,651,223 | Forward primer sequence (position 136,651,203 – 136,651,223): '''5'TCCCTGCGCAAACACATGAA3'''' | ||
Reverse primer sequence (200 base pairs to the right | Reverse primer sequence (200 base pairs to the right): '''3'TCCCAACTTTGCTCACTCCC5'''' | ||
A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the '''A''' gene, it will not yield a PCR product and will instead amplify the healthy allele expression. | A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the '''A''' gene, it will not yield a PCR product and will instead amplify the healthy allele expression. | ||
Line 229: | Line 238: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:BME103_Group1_Heterotaxy_primer. | [[Image:BME103_Group1_Heterotaxy_primer.jpg|800px|Heterotaxy PCR primer design]] | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 18:34, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
Each DNA solution consists of
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxy, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223): 5'TCCCTGCGCAAACACATGAA3' Reverse primer sequence (200 base pairs to the right): 3'TCCCAACTTTGCTCACTCCC5' A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration
|