BME103:W930 Group1 l2: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
Line 143: | Line 143: | ||
#Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.<br> | #Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.<br> | ||
#Dilute the contents of the test tube by filling its remainder with deionized water.<br> | #Dilute the contents of the test tube by filling its remainder with deionized water.<br> | ||
#Repeat steps 5-9 for each of the seven remaining DNA samples including the positive and negative controls using different pipettes to transfer each substance.<br> | #Repeat steps 5-9 for each of the seven remaining DNA samples including the positive and negative controls using different pipettes to transfer<br> each substance.<br> | ||
#Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it barely touches the tops of the tubes.<br> | #Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it<br> barely touches the tops of the tubes.<br> | ||
#Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative controls accordingly. | #Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative<br> controls accordingly.<br> | ||
#Click on “Plug in Open PCR to start” to begin amplifying DNA samples.<br> | #Click on “Plug in Open PCR to start” to begin amplifying DNA samples.<br> | ||
#Carefully observe the display screen on the lid of the Open PCR with the quantities that appear on the computer.<br> | #Carefully observe the display screen on the lid of the Open PCR with the quantities that appear on the computer.<br> |
Revision as of 21:58, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
Each DNA solution consists of
Note that that positive control is calf thymus DNA, and the negative control is a blank solution of water.
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47 |