BME103:W930 Group10 l2

From OpenWetWare
Revision as of 22:08, 27 November 2012 by Rachel Lundeen (talk | contribs) (Research and Development)
Jump to: navigation, search
Owwnotebook icon.png BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png

OUR TEAM

Name: Susan Sajadi
Role(s)
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth Lopez
Role(s)
Name: Britny Sepulveda
Role(s)
Name: Raymond Feliciano
Role(s)
Name: Colin Siguenza
Role(s)
Name: Rotem Beger
Role(s)
Name: Lars Moss
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students.


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood.


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:



Illustration