Difference between revisions of "BME103:T930 Group 7 l2"

From OpenWetWare
Jump to: navigation, search
(Thermal Cycler Engineering)
(Thermal Cycler Engineering)
Line 29: Line 29:
  
 
'''System Design'''<br>
 
'''System Design'''<br>
<systemchange.png>
+
[[Image:systemchange.png]]
  
  

Revision as of 09:47, 18 November 2012

Owwnotebook icon.png BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png

OUR TEAM

Name: Student: Elyse Candell
Role(s: Machine Engineer)
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Systemchange.png


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Test Tubes 32
Micropipette (10uL-100uL) 1
Disposable Pipette tips 100
PCR Reaction Mix 2 mL


Supplied by User Amount
Smartphone or Computer 1
Bluetooth Capability in Phone 1
USB Cord with Computer 1
Patient Samples 50 uL per Test Tube



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

rs74315509
This SNP is linked to schizophrenia.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509



Primer Design


forward primer: AGGGGGGCCAGGGCCTCAGTG
reverse primer: TGCCTTCCGC A CGAGCCCGTC
The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially.


Illustration

BME103 Group-7 schiz repl.jpg