Difference between revisions of "BME103:T930 Group 3 l2"

From OpenWetWare
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 95: Line 95:
  
 
1.) Forward primer: CTTC[G]ACCT
 
1.) Forward primer: CTTC[G]ACCT
    Reverse primer: TCCA[G]CTTC <br>
+
  Reverse primer: TCCA[G]CTTC <br>
 
2.) Forward primer: TGTT[A]CAGG
 
2.) Forward primer: TGTT[A]CAGG
    Reverse primer: GGAC[A]TTGT <br><br>
+
  Reverse primer: GGAC[A]TTGT <br><br>
  
  

Revision as of 21:25, 22 November 2012

Owwnotebook icon.png BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png

OUR TEAM

Name: Lekha Anantuni
Role: R&D
Name: Rohan Kumar
Role(s)
Name: Kyle Stoneking
Role(s)
Name: Austin Cuaderno
Role(s)
Name: Josh Eger
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


1.) The amyloid Beta precursor protein for Alzheimer's -
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy -
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG

Primer Design


1.) Forward primer: CTTC[G]ACCT

  Reverse primer: TCCA[G]CTTC 

2.) Forward primer: TGTT[A]CAGG

  Reverse primer: GGAC[A]TTGT 


Illustration


Exponential amplification of a specific gene.