Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
What changes are we making to our system? Will have to take another picture with changes before class!
Key Features
Our re-designed system will have the adjusting screw removed, and instead will be fixed at a set level so that the operator will not have to fiddle with adjusting the lid and can simply just open and close the lid with ease without worrying about the height of the heating plate.
Instructions
The instructions for this system are the same as the old system, minus having to adjust the height of the heating plate.
Protocols
Materials
Supplied in the kit
Amount
PCR Assembly
1
Fluorimeter
1
Phone Stand
1
Box
1
Supplied by User
Amount
Samples
3 samples per subject
Positive & Negative controls
1 each
Calibrator (Calif.../water blank)
1 each
Enzyme/Primer mix
Enough for all the samples
Test tubes
1 for each sample, and control
Pippettes
1 for each sample, control, and calibration solution
PCR Protocol
Procedure:
Preparing the DNA samples
Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control
Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA, using a new pipette tip for ever sample transfer. The PCR reaction mix is composed of:
0.2 μL Template DNA (20 ng)
1.0 μL 10 μM forward primer
1.0 μL 10 μM reverse primer
50.0 μL GoTaq master mix
2X Colorless GoTaq® Reaction Buffer( pH 8.5)
400μM dATP
400μM dGTP
400μM dCTP
400μM dTTP
3mM MgCl2.
47.8 μL dH2O (A total volume of 100.0 μL)
The eight prepared samples should be placed into a refrigerator until they are placed into the Open PCR Machine.
Setting up the Open PCR Machine
The Open PCR Machine must be plugged in and connected to a computer through a USB port and cable.
The PCR machine holds 16 samples, only 8 of the wells will be used in this situation. Place the wells horizontally to the lid hinge, in the inner well rows.
Close the lid and ensure that it snaps down completely
Once the machine is turned on and plugged into the computer, with software already downloaded, the test should be programed as follows
30 cycles must be run of the following pattern
90ºC for 30 seconds
57ºC for 30 seconds
72ºC for 30 seconds
The reaction will run its course in 1-2 hours during which period the machine should be monitored as it can get extremely hot.
After a few minutes the DNA samples should be removed from the machine and placed into the refrigerator until they are going to be analysed.
DNA Measurement ProtocolDNA Sample Preparation
Obtain all the DNA samples run through the Open PCR machine along with calf thymus DNA and a water sample.
Take the provided Eppendorf tubes with 400 mL of buffer solution and label them in conjuction with labeling pipettes. Maintain constant labels to avoid contamination.
Transfer each DNA sample, positive control, negative control, and calf thymus DNA into a separate eppendorf tube with its labeled pipette. This does not need to be done with water.
Fluorimeter Setup
Procedure:
Obtain a box of materials including: Fluorimeter, phone stand, hydrophobic slides, pipettes, Sybr Green, and the 9 eppendorf tubes prepared earlier.
The hydrophobic slide (polymer side up) should be placed onto the LED box with the first two rows of nodes centered with the LED light.
For each sample two drops of the Sybr Green Dye are added to the center nodes of the slide. That is, in the first two horizontal rows with the two central dots of each connecting. One drop for each node, or until the two drops coalesce.
Two drops of the subjects DNA mixture (or positive/negative control or Calf Thymus DNA or water sample as appropriate) solution were added to the dye.
The LED was turned on and the phone camera was centered onto the drop, held up by the stand.
The dark box was placed over the whole setup and closed as completely as possible.
A picture was taken and sent to the ImageJ program to be analyzed.
The drop was removed and disposed of and the slide was re centered on the next two nodes.
The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire procedure.
Research and Development
Background on Disease Markers
ALZHEIMER'S DISEASE (AD)
As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful
amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.
Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT.
Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.